\
| Variant ID: vg1218210959 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18210959 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAAGGAAAAACTAGAGATAACATGTGTTTTTGTTGTCGACCCGATCCGGACCGTCTGTATGAAAACATAACATATTTTATTCTAAAATAATAGTTCTT[C/T]
AATTTATGTTTGCACCATCGGAAAACCACGTGTTTTTTATCTACCCGGTCTGGACAGATAAGATGAAATCCAGCCGTAACATATTTTGTACAAAAATAGT
ACTATTTTTGTACAAAATATGTTACGGCTGGATTTCATCTTATCTGTCCAGACCGGGTAGATAAAAAACACGTGGTTTTCCGATGGTGCAAACATAAATT[G/A]
AAGAACTATTATTTTAGAATAAAATATGTTATGTTTTCATACAGACGGTCCGGATCGGGTCGACAACAAAAACACATGTTATCTCTAGTTTTTCCTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.90% | 19.60% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 2.70% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 50.00% | 49.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 2.00% | 1.85% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 5.60% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 63.80% | 36.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 27.20% | 72.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.90% | 46.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 36.50% | 61.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 22.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218210959 | C -> T | LOC_Os12g30340.1 | upstream_gene_variant ; 2063.0bp to feature; MODIFIER | silent_mutation | Average:33.263; most accessible tissue: Callus, score: 70.074 | N | N | N | N |
| vg1218210959 | C -> T | LOC_Os12g30330.1 | downstream_gene_variant ; 2401.0bp to feature; MODIFIER | silent_mutation | Average:33.263; most accessible tissue: Callus, score: 70.074 | N | N | N | N |
| vg1218210959 | C -> T | LOC_Os12g30330-LOC_Os12g30340 | intergenic_region ; MODIFIER | silent_mutation | Average:33.263; most accessible tissue: Callus, score: 70.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218210959 | NA | 5.33E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | 9.18E-06 | NA | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | 3.37E-06 | NA | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | 2.50E-06 | 7.85E-06 | mr1048 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 4.14E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.78E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 2.48E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 3.42E-08 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 2.49E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 9.19E-07 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 2.20E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.00E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 3.43E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 6.66E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 4.17E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.63E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 2.91E-07 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 4.14E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 5.80E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.96E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 4.94E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 3.27E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 2.88E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 4.29E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 3.81E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.29E-09 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 2.16E-07 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 7.72E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 7.72E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 6.80E-10 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.16E-08 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 3.96E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | 8.35E-06 | 4.10E-06 | mr1948 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218210959 | NA | 1.60E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |