Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218209454:

Variant ID: vg1218209454 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18209454
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGGGGAGGGGGAGGAAGATTAAGAAGGGGCGGAGGAGATGGCAGTTGCTAGTGTCGCACTCAAACGGGAGAGGAGGAAACGACGGTCGTCGACGTCCA[C/T]
GCTCGACTACGAGCGGAGGTGGCAGCCGGCGTCATCACACTGCGAGCGGGAACAGAGGAGGCGGTGGGCAAAGCCATTGGCAAGCTGGAATAAAGGCCGG

Reverse complement sequence

CCGGCCTTTATTCCAGCTTGCCAATGGCTTTGCCCACCGCCTCCTCTGTTCCCGCTCGCAGTGTGATGACGCCGGCTGCCACCTCCGCTCGTAGTCGAGC[G/A]
TGGACGTCGACGACCGTCGTTTCCTCCTCTCCCGTTTGAGTGCGACACTAGCAACTGCCATCTCCTCCGCCCCTTCTTAATCTTCCTCCCCCTCCCCCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 39.90% 1.97% 7.77% NA
All Indica  2759 28.60% 55.90% 3.04% 12.40% NA
All Japonica  1512 93.00% 6.90% 0.07% 0.00% NA
Aus  269 23.80% 65.10% 2.60% 8.55% NA
Indica I  595 36.50% 49.40% 5.38% 8.74% NA
Indica II  465 33.10% 52.50% 2.58% 11.83% NA
Indica III  913 25.30% 55.90% 2.52% 16.32% NA
Indica Intermediate  786 23.90% 63.00% 2.16% 10.94% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 4.80% 0.20% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218209454 C -> DEL N N silent_mutation Average:76.937; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N
vg1218209454 C -> T LOC_Os12g30340.1 upstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:76.937; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N
vg1218209454 C -> T LOC_Os12g30320.1 downstream_gene_variant ; 4652.0bp to feature; MODIFIER silent_mutation Average:76.937; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N
vg1218209454 C -> T LOC_Os12g30330.1 downstream_gene_variant ; 896.0bp to feature; MODIFIER silent_mutation Average:76.937; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N
vg1218209454 C -> T LOC_Os12g30330-LOC_Os12g30340 intergenic_region ; MODIFIER silent_mutation Average:76.937; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218209454 C T 0.0 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218209454 NA 7.91E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 NA 1.29E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 NA 2.44E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 NA 7.32E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 NA 7.32E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 NA 9.41E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 3.15E-07 3.15E-07 mr1456_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218209454 NA 7.81E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251