Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218208697:

Variant ID: vg1218208697 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18208697
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AACTAAAGAGGTGGAGCTGGTTTTAGGCAGCACCTCAACTCCACTCTAGACCCAACTTCTGAAGTTAAATTTAGGAGTTAGAGCTCTACCAAACAGGCCA[A/G]
CTAATGCGATATGTTAAAAGTTGTCAAAATTTAATAAAAAAATTGGCAGAACCTCCCCGGTACTTATGAACCTCCCCAGGACTAAAGAACACTACGAGAG

Reverse complement sequence

CTCTCGTAGTGTTCTTTAGTCCTGGGGAGGTTCATAAGTACCGGGGAGGTTCTGCCAATTTTTTTATTAAATTTTGACAACTTTTAACATATCGCATTAG[T/C]
TGGCCTGTTTGGTAGAGCTCTAACTCCTAAATTTAACTTCAGAAGTTGGGTCTAGAGTGGAGTTGAGGTGCTGCCTAAAACCAGCTCCACCTCTTTAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 15.00% 0.89% 0.21% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 55.70% 41.50% 2.18% 0.66% NA
Aus  269 92.90% 5.90% 1.12% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 27.60% 71.10% 1.17% 0.13% NA
Tropical Japonica  504 92.30% 2.00% 4.17% 1.59% NA
Japonica Intermediate  241 68.50% 29.90% 1.24% 0.41% NA
VI/Aromatic  96 78.10% 19.80% 2.08% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218208697 A -> DEL N N silent_mutation Average:69.462; most accessible tissue: Callus, score: 80.864 N N N N
vg1218208697 A -> G LOC_Os12g30340.1 upstream_gene_variant ; 4325.0bp to feature; MODIFIER silent_mutation Average:69.462; most accessible tissue: Callus, score: 80.864 N N N N
vg1218208697 A -> G LOC_Os12g30320.1 downstream_gene_variant ; 3895.0bp to feature; MODIFIER silent_mutation Average:69.462; most accessible tissue: Callus, score: 80.864 N N N N
vg1218208697 A -> G LOC_Os12g30330.1 downstream_gene_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:69.462; most accessible tissue: Callus, score: 80.864 N N N N
vg1218208697 A -> G LOC_Os12g30330-LOC_Os12g30340 intergenic_region ; MODIFIER silent_mutation Average:69.462; most accessible tissue: Callus, score: 80.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218208697 NA 4.90E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 7.99E-06 NA mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.04E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 2.79E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.02E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.49E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.70E-19 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.81E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.78E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 2.62E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.82E-17 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 5.53E-06 NA mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 4.63E-29 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 4.55E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 2.46E-06 NA mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.82E-17 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.62E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.45E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 3.72E-06 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 2.77E-06 2.77E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 6.81E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.03E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.79E-41 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.33E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 5.24E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 5.22E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.05E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.81E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.21E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.57E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 1.84E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 1.44E-07 NA mr1819 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 4.17E-06 9.58E-09 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 4.24E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 6.67E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 8.60E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 3.61E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 5.14E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 6.59E-06 3.28E-07 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 5.26E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 5.07E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218208697 NA 7.77E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251