| Variant ID: vg1218194292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18194292 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCAAAACACTAGACATAGTTTCCATAAACTCCACATTATCAAGAAACTAGTATTAGACACTACTCTTCCAATGCAAACACTACTATTTCATACTTAAAT[T/A]
TAATGCTACTTATCTCACATAATGTCTTGGATGTTGTGTAGAAACCATGTCTCATGTAAGACATAGTTTTCTTCTCTTTCCTCATTTATTCACTTGCCAC
GTGGCAAGTGAATAAATGAGGAAAGAGAAGAAAACTATGTCTTACATGAGACATGGTTTCTACACAACATCCAAGACATTATGTGAGATAAGTAGCATTA[A/T]
ATTTAAGTATGAAATAGTAGTGTTTGCATTGGAAGAGTAGTGTCTAATACTAGTTTCTTGATAATGTGGAGTTTATGGAAACTATGTCTAGTGTTTTGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 0.40% | 0.74% | 5.88% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 86.50% | 1.20% | 0.73% | 11.57% | NA |
| Aus | 269 | 69.90% | 0.00% | 1.49% | 28.62% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.40% | 0.00% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 84.60% | 2.30% | 1.17% | 11.86% | NA |
| Tropical Japonica | 504 | 96.00% | 0.00% | 0.40% | 3.57% | NA |
| Japonica Intermediate | 241 | 72.60% | 0.00% | 0.00% | 27.39% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 13.54% | 19.79% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218194292 | T -> DEL | N | N | silent_mutation | Average:49.738; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1218194292 | T -> A | LOC_Os12g30310.1 | downstream_gene_variant ; 4633.0bp to feature; MODIFIER | silent_mutation | Average:49.738; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1218194292 | T -> A | LOC_Os12g30310-LOC_Os12g30320 | intergenic_region ; MODIFIER | silent_mutation | Average:49.738; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218194292 | 4.33E-06 | 1.05E-13 | Awn_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1218194292 | 2.08E-06 | 6.97E-08 | mr1201 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218194292 | NA | 5.19E-06 | mr1219 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218194292 | 2.87E-07 | 4.02E-08 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218194292 | NA | 1.56E-07 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |