\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218194091:

Variant ID: vg1218194091 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18194091
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAATACGGAGGGAGGGAGTATATTTCTTAGTTTTTCCTTTTAAGTTTTCCTGGAAAGTCACCAGTTCCCGTGGACTATTATATACCTGTTTAGTTAG[A/T]
TCACATACGCGCTCCCCCGGAAGTACTTGTTATGAGGGCCATATATTGTTCATCAGAGACAGAGTTTTACCAATGTATAGCGAGCTTAGGCCATTCCCAA

Reverse complement sequence

TTGGGAATGGCCTAAGCTCGCTATACATTGGTAAAACTCTGTCTCTGATGAACAATATATGGCCCTCATAACAAGTACTTCCGGGGGAGCGCGTATGTGA[T/A]
CTAACTAAACAGGTATATAATAGTCCACGGGAACTGGTGACTTTCCAGGAAAACTTAAAAGGAAAAACTAAGAAATATACTCCCTCCCTCCGTATTTTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 28.60% 0.59% 4.00% NA
All Indica  2759 96.90% 2.70% 0.25% 0.14% NA
All Japonica  1512 14.00% 77.90% 0.73% 7.41% NA
Aus  269 76.20% 1.10% 2.60% 20.07% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 98.90% 0.90% 0.11% 0.11% NA
Indica Intermediate  786 93.80% 5.20% 0.64% 0.38% NA
Temperate Japonica  767 2.10% 85.00% 0.78% 12.13% NA
Tropical Japonica  504 24.60% 75.20% 0.00% 0.20% NA
Japonica Intermediate  241 29.50% 61.00% 2.07% 7.47% NA
VI/Aromatic  96 33.30% 43.80% 3.12% 19.79% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218194091 A -> DEL N N silent_mutation Average:38.946; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1218194091 A -> T LOC_Os12g30310.1 downstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:38.946; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1218194091 A -> T LOC_Os12g30310-LOC_Os12g30320 intergenic_region ; MODIFIER silent_mutation Average:38.946; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218194091 1.63E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 1.10E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 7.06E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 4.13E-07 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 1.16E-10 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 9.98E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 6.95E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 7.01E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 2.15E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 3.04E-18 mr1376 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 3.04E-18 mr1431 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 7.44E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 4.22E-39 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 1.86E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 7.46E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 8.09E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 1.77E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 1.34E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 1.43E-06 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 4.87E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218194091 NA 3.74E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251