\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218193308:

Variant ID: vg1218193308 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18193308
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAGATGTGTACTTTATAAGTTTATGGATCTAAATGATACTCTGGTAGATATTTAAGGACCAACCATGTATTTTGCTATCTGAGATACGGAGGGTGTT[G/C,A]
AAAAAGCAATGCATTCTCTCATCCTCCGGCCCTTATATATATCACCCCCATCTCTAAACATTTAATTAATTTACTCCTATTATATAGCTAACTTGTAAAA

Reverse complement sequence

TTTTACAAGTTAGCTATATAATAGGAGTAAATTAATTAAATGTTTAGAGATGGGGGTGATATATATAAGGGCCGGAGGATGAGAGAATGCATTGCTTTTT[C/G,T]
AACACCCTCCGTATCTCAGATAGCAAAATACATGGTTGGTCCTTAAATATCTACCAGAGTATCATTTAGATCCATAAACTTATAAAGTACACATCTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 7.20% 0.04% 4.00% A: 0.47%
All Indica  2759 91.30% 8.40% 0.00% 0.22% A: 0.04%
All Japonica  1512 92.60% 0.10% 0.07% 7.28% NA
Aus  269 44.20% 35.30% 0.00% 19.70% A: 0.74%
Indica I  595 93.90% 6.10% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 90.80% 9.00% 0.00% 0.11% A: 0.11%
Indica Intermediate  786 87.70% 11.70% 0.00% 0.64% NA
Temperate Japonica  767 87.90% 0.10% 0.00% 11.99% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 92.50% 0.00% 0.41% 7.05% NA
VI/Aromatic  96 58.30% 6.20% 1.04% 20.83% A: 13.54%
Intermediate  90 90.00% 3.30% 0.00% 0.00% A: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218193308 G -> C LOC_Os12g30310.1 downstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:42.191; most accessible tissue: Callus, score: 69.849 N N N N
vg1218193308 G -> C LOC_Os12g30310-LOC_Os12g30320 intergenic_region ; MODIFIER silent_mutation Average:42.191; most accessible tissue: Callus, score: 69.849 N N N N
vg1218193308 G -> DEL N N silent_mutation Average:42.191; most accessible tissue: Callus, score: 69.849 N N N N
vg1218193308 G -> A LOC_Os12g30310.1 downstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:42.191; most accessible tissue: Callus, score: 69.849 N N N N
vg1218193308 G -> A LOC_Os12g30310-LOC_Os12g30320 intergenic_region ; MODIFIER silent_mutation Average:42.191; most accessible tissue: Callus, score: 69.849 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218193308 9.26E-06 NA mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 1.31E-09 1.31E-09 mr1321 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 7.66E-06 NA mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 1.58E-07 1.58E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 1.11E-07 3.45E-08 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 4.42E-07 1.62E-07 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 1.34E-06 6.66E-07 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 2.05E-06 6.76E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 NA 6.84E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 2.08E-06 NA mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 6.15E-06 6.15E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 NA 5.17E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218193308 1.04E-06 1.17E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251