\
| Variant ID: vg1218193308 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18193308 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.00, others allele: 0.00, population size: 254. )
ATATAGATGTGTACTTTATAAGTTTATGGATCTAAATGATACTCTGGTAGATATTTAAGGACCAACCATGTATTTTGCTATCTGAGATACGGAGGGTGTT[G/C,A]
AAAAAGCAATGCATTCTCTCATCCTCCGGCCCTTATATATATCACCCCCATCTCTAAACATTTAATTAATTTACTCCTATTATATAGCTAACTTGTAAAA
TTTTACAAGTTAGCTATATAATAGGAGTAAATTAATTAAATGTTTAGAGATGGGGGTGATATATATAAGGGCCGGAGGATGAGAGAATGCATTGCTTTTT[C/G,T]
AACACCCTCCGTATCTCAGATAGCAAAATACATGGTTGGTCCTTAAATATCTACCAGAGTATCATTTAGATCCATAAACTTATAAAGTACACATCTATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 7.20% | 0.04% | 4.00% | A: 0.47% |
| All Indica | 2759 | 91.30% | 8.40% | 0.00% | 0.22% | A: 0.04% |
| All Japonica | 1512 | 92.60% | 0.10% | 0.07% | 7.28% | NA |
| Aus | 269 | 44.20% | 35.30% | 0.00% | 19.70% | A: 0.74% |
| Indica I | 595 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.80% | 9.00% | 0.00% | 0.11% | A: 0.11% |
| Indica Intermediate | 786 | 87.70% | 11.70% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 87.90% | 0.10% | 0.00% | 11.99% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.00% | 0.41% | 7.05% | NA |
| VI/Aromatic | 96 | 58.30% | 6.20% | 1.04% | 20.83% | A: 13.54% |
| Intermediate | 90 | 90.00% | 3.30% | 0.00% | 0.00% | A: 6.67% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218193308 | G -> C | LOC_Os12g30310.1 | downstream_gene_variant ; 3649.0bp to feature; MODIFIER | silent_mutation | Average:42.191; most accessible tissue: Callus, score: 69.849 | N | N | N | N |
| vg1218193308 | G -> C | LOC_Os12g30310-LOC_Os12g30320 | intergenic_region ; MODIFIER | silent_mutation | Average:42.191; most accessible tissue: Callus, score: 69.849 | N | N | N | N |
| vg1218193308 | G -> DEL | N | N | silent_mutation | Average:42.191; most accessible tissue: Callus, score: 69.849 | N | N | N | N |
| vg1218193308 | G -> A | LOC_Os12g30310.1 | downstream_gene_variant ; 3649.0bp to feature; MODIFIER | silent_mutation | Average:42.191; most accessible tissue: Callus, score: 69.849 | N | N | N | N |
| vg1218193308 | G -> A | LOC_Os12g30310-LOC_Os12g30320 | intergenic_region ; MODIFIER | silent_mutation | Average:42.191; most accessible tissue: Callus, score: 69.849 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218193308 | 9.26E-06 | NA | mr1320 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 1.31E-09 | 1.31E-09 | mr1321 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 7.66E-06 | NA | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 1.58E-07 | 1.58E-07 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 1.11E-07 | 3.45E-08 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 4.42E-07 | 1.62E-07 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 1.34E-06 | 6.66E-07 | mr1326 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 2.05E-06 | 6.76E-07 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | NA | 6.84E-07 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 2.08E-06 | NA | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 6.15E-06 | 6.15E-06 | mr1545 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | NA | 5.17E-06 | mr1579 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218193308 | 1.04E-06 | 1.17E-06 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |