Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218191046:

Variant ID: vg1218191046 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18191046
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GACCTTGGCAGTAGCAGAAATCCCTAGGTCCAAAACACATTTGATGGGTCTGGATCAGTAAGAGCAAGTTTAATAGTATAGCCAACTACTAGCTGCAATT[C/T]
ATCTATAGCTAATCTAATAGCTTATTCATATAATATATAGTTACATACTACACTATTAATACATGATCCCACCTATCATACACACATTGCGTCTTGGAGT

Reverse complement sequence

ACTCCAAGACGCAATGTGTGTATGATAGGTGGGATCATGTATTAATAGTGTAGTATGTAACTATATATTATATGAATAAGCTATTAGATTAGCTATAGAT[G/A]
AATTGCAGCTAGTAGTTGGCTATACTATTAAACTTGCTCTTACTGATCCAGACCCATCAAATGTGTTTTGGACCTAGGGATTTCTGCTACTGCCAAGGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	7.60%	0.15%	4.72%	NA
All Indica	2759	95.50%	3.80%	0.04%	0.65%	NA
All Japonica	1512	80.00%	12.30%	0.33%	7.41%	NA
Aus	269	56.90%	22.30%	0.37%	20.45%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	89.70%	9.20%	0.00%	1.08%	NA
Indica III	913	97.40%	2.50%	0.00%	0.11%	NA
Indica Intermediate	786	94.00%	4.30%	0.13%	1.53%	NA
Temperate Japonica	767	87.20%	0.40%	0.26%	12.13%	NA
Tropical Japonica	504	76.00%	23.60%	0.20%	0.20%	NA
Japonica Intermediate	241	65.10%	26.60%	0.83%	7.47%	NA
VI/Aromatic	96	60.40%	6.20%	0.00%	33.33%	NA
Intermediate	90	87.80%	5.60%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218191046	C -> DEL	N	N	silent_mutation	Average:55.654; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg1218191046	C -> T	LOC_Os12g30310.1	downstream_gene_variant ; 1387.0bp to feature; MODIFIER	silent_mutation	Average:55.654; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg1218191046	C -> T	LOC_Os12g30310-LOC_Os12g30320	intergenic_region ; MODIFIER	silent_mutation	Average:55.654; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218191046	NA	5.34E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	2.74E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	5.73E-06	NA	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	1.05E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	8.87E-06	2.38E-07	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	8.76E-06	8.75E-06	mr1267	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	2.17E-06	2.17E-06	mr1299	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	1.43E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	4.81E-07	3.51E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	2.92E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	1.14E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	3.40E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	9.93E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	1.26E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	5.61E-06	mr1427	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	1.78E-07	1.70E-07	mr1443	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	8.65E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	4.63E-06	4.63E-06	mr1564	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	6.59E-06	NA	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	2.39E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	6.09E-06	mr1743	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	8.19E-07	NA	mr1819	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	2.28E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	8.07E-06	NA	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	NA	6.55E-06	mr1884	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218191046	4.83E-06	4.83E-06	mr1948	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251