| Variant ID: vg1218179477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18179477 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )
ACAAGCATGGTCTTGATAAGACGCAAAAGATCTTGCTGGCAGACATTCTAAGATGTCTGGCCTGTATGTCACAAAGTCTCGTGAAGTCTAGAAAAGTTGT[C/T]
GAGGATGAAGCTCCACATGAACTCTTACATGCACAAGACCACAGACAATGAGAAATTTTGAGAGAAGTTTCTTTGACCAATCACAAATCTCAAAGTAGTT
AACTACTTTGAGATTTGTGATTGGTCAAAGAAACTTCTCTCAAAATTTCTCATTGTCTGTGGTCTTGTGCATGTAAGAGTTCATGTGGAGCTTCATCCTC[G/A]
ACAACTTTTCTAGACTTCACGAGACTTTGTGACATACAGGCCAGACATCTTAGAATGTCTGCCAGCAAGATCTTTTGCGTCTTATCAAGACCATGCTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.80% | 3.60% | 0.74% | 17.84% | NA |
| All Indica | 2759 | 96.50% | 1.90% | 0.14% | 1.49% | NA |
| All Japonica | 1512 | 44.40% | 7.40% | 1.59% | 46.56% | NA |
| Aus | 269 | 94.40% | 0.00% | 0.00% | 5.58% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.00% | 1.68% | NA |
| Indica II | 465 | 90.50% | 9.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 99.30% | 0.00% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 95.30% | 1.30% | 0.38% | 3.05% | NA |
| Temperate Japonica | 767 | 65.60% | 0.30% | 0.91% | 33.25% | NA |
| Tropical Japonica | 504 | 8.90% | 19.60% | 3.17% | 68.25% | NA |
| Japonica Intermediate | 241 | 51.50% | 4.60% | 0.41% | 43.57% | NA |
| VI/Aromatic | 96 | 25.00% | 4.20% | 3.12% | 67.71% | NA |
| Intermediate | 90 | 74.40% | 1.10% | 4.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218179477 | C -> DEL | N | N | silent_mutation | Average:36.406; most accessible tissue: Callus, score: 73.926 | N | N | N | N |
| vg1218179477 | C -> T | LOC_Os12g30290-LOC_Os12g30310 | intergenic_region ; MODIFIER | silent_mutation | Average:36.406; most accessible tissue: Callus, score: 73.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218179477 | NA | 6.37E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218179477 | NA | 4.08E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218179477 | NA | 6.20E-06 | mr1884 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218179477 | 4.10E-06 | 1.91E-08 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218179477 | 2.45E-06 | 2.45E-06 | mr1925_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |