\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218179477:

Variant ID: vg1218179477 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18179477
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGCATGGTCTTGATAAGACGCAAAAGATCTTGCTGGCAGACATTCTAAGATGTCTGGCCTGTATGTCACAAAGTCTCGTGAAGTCTAGAAAAGTTGT[C/T]
GAGGATGAAGCTCCACATGAACTCTTACATGCACAAGACCACAGACAATGAGAAATTTTGAGAGAAGTTTCTTTGACCAATCACAAATCTCAAAGTAGTT

Reverse complement sequence

AACTACTTTGAGATTTGTGATTGGTCAAAGAAACTTCTCTCAAAATTTCTCATTGTCTGTGGTCTTGTGCATGTAAGAGTTCATGTGGAGCTTCATCCTC[G/A]
ACAACTTTTCTAGACTTCACGAGACTTTGTGACATACAGGCCAGACATCTTAGAATGTCTGCCAGCAAGATCTTTTGCGTCTTATCAAGACCATGCTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 3.60% 0.74% 17.84% NA
All Indica  2759 96.50% 1.90% 0.14% 1.49% NA
All Japonica  1512 44.40% 7.40% 1.59% 46.56% NA
Aus  269 94.40% 0.00% 0.00% 5.58% NA
Indica I  595 98.30% 0.00% 0.00% 1.68% NA
Indica II  465 90.50% 9.00% 0.00% 0.43% NA
Indica III  913 99.30% 0.00% 0.11% 0.55% NA
Indica Intermediate  786 95.30% 1.30% 0.38% 3.05% NA
Temperate Japonica  767 65.60% 0.30% 0.91% 33.25% NA
Tropical Japonica  504 8.90% 19.60% 3.17% 68.25% NA
Japonica Intermediate  241 51.50% 4.60% 0.41% 43.57% NA
VI/Aromatic  96 25.00% 4.20% 3.12% 67.71% NA
Intermediate  90 74.40% 1.10% 4.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218179477 C -> DEL N N silent_mutation Average:36.406; most accessible tissue: Callus, score: 73.926 N N N N
vg1218179477 C -> T LOC_Os12g30290-LOC_Os12g30310 intergenic_region ; MODIFIER silent_mutation Average:36.406; most accessible tissue: Callus, score: 73.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218179477 NA 6.37E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218179477 NA 4.08E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218179477 NA 6.20E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218179477 4.10E-06 1.91E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218179477 2.45E-06 2.45E-06 mr1925_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251