\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218173208:

Variant ID: vg1218173208 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18173208
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTACATCCTCCTTTGTGGCGTACCACCATTCTGGGCTGGTAGGCACACACTATTGACACACCACTTTTCACTTGGTTTCCAGCATGTATCTTGAACT[A/C]
TGACACAAAATTGCTTGTTACCGCCGTATTTTCACAGATACAAAGCAGGGGGTATTTGACAAGGTGCTGCATGGCATGCTAGAATTTGACGCGGATCCGT

Reverse complement sequence

ACGGATCCGCGTCAAATTCTAGCATGCCATGCAGCACCTTGTCAAATACCCCCTGCTTTGTATCTGTGAAAATACGGCGGTAACAAGCAATTTTGTGTCA[T/G]
AGTTCAAGATACATGCTGGAAACCAAGTGAAAAGTGGTGTGTCAATAGTGTGTGCCTACCAGCCCAGAATGGTGGTACGCCACAAAGGAGGATGTAGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 7.20% 0.93% 0.00% NA
All Indica  2759 88.50% 9.90% 1.56% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.07% 0.00% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 61.80% 31.90% 6.22% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 95.80% 4.20% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 5.20% 0.76% 0.00% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218173208 A -> C LOC_Os12g30290.1 upstream_gene_variant ; 4164.0bp to feature; MODIFIER silent_mutation Average:69.6; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N
vg1218173208 A -> C LOC_Os12g30290-LOC_Os12g30310 intergenic_region ; MODIFIER silent_mutation Average:69.6; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218173208 NA 2.89E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 1.55E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 2.81E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 1.01E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 3.73E-10 mr1904 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 1.19E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 2.79E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 3.78E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 3.51E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208 NA 1.64E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251