Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218173208:

Variant ID: vg1218173208 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18173208
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTACATCCTCCTTTGTGGCGTACCACCATTCTGGGCTGGTAGGCACACACTATTGACACACCACTTTTCACTTGGTTTCCAGCATGTATCTTGAACT[A/C]
TGACACAAAATTGCTTGTTACCGCCGTATTTTCACAGATACAAAGCAGGGGGTATTTGACAAGGTGCTGCATGGCATGCTAGAATTTGACGCGGATCCGT

Reverse complement sequence

ACGGATCCGCGTCAAATTCTAGCATGCCATGCAGCACCTTGTCAAATACCCCCTGCTTTGTATCTGTGAAAATACGGCGGTAACAAGCAATTTTGTGTCA[T/G]
AGTTCAAGATACATGCTGGAAACCAAGTGAAAAGTGGTGTGTCAATAGTGTGTGCCTACCAGCCCAGAATGGTGGTACGCCACAAAGGAGGATGTAGATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	7.20%	0.93%	0.00%	NA
All Indica	2759	88.50%	9.90%	1.56%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.07%	0.00%	NA
Aus	269	87.70%	12.30%	0.00%	0.00%	NA
Indica I	595	61.80%	31.90%	6.22%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	95.80%	4.20%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	5.20%	0.76%	0.00%	NA
Temperate Japonica	767	99.20%	0.70%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218173208	A -> C	LOC_Os12g30290.1	upstream_gene_variant ; 4164.0bp to feature; MODIFIER	silent_mutation	Average:69.6; most accessible tissue: Zhenshan97 young leaf, score: 85.886	N	N	N	N
vg1218173208	A -> C	LOC_Os12g30290-LOC_Os12g30310	intergenic_region ; MODIFIER	silent_mutation	Average:69.6; most accessible tissue: Zhenshan97 young leaf, score: 85.886	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218173208	NA	2.89E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	1.55E-07	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	2.81E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	1.01E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	3.73E-10	mr1904	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	1.19E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	2.79E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	3.78E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	3.51E-06	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218173208	NA	1.64E-09	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251