\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218169215:

Variant ID: vg1218169215 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18169215
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTGTGAGAAAGATCCTGCAACTTGTAAGGTCGTGAGACCTAGATTTGTGAATTGGGCGTTATGTGACTCCTGTCGGTGAAGTGCGTTGAATCCCAC[A/G]
CTCCTAGCAGGCGTAGAGTTCAGCTTTCACGTGGAGTATCACCGGGCAATCCTCGAGAATATACTTGGATGTCAGCTTTTAGGTAGTATTCCTTGTCAGC

Reverse complement sequence

GCTGACAAGGAATACTACCTAAAAGCTGACATCCAAGTATATTCTCGAGGATTGCCCGGTGATACTCCACGTGAAAGCTGAACTCTACGCCTGCTAGGAG[T/C]
GTGGGATTCAACGCACTTCACCGACAGGAGTCACATAACGCCCAATTCACAAATCTAGGTCTCACGACCTTACAAGTTGCAGGATCTTTCTCACAACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 32.10% 0.42% 21.37% NA
All Indica  2759 63.50% 3.10% 0.58% 32.84% NA
All Japonica  1512 14.10% 85.60% 0.00% 0.33% NA
Aus  269 60.20% 7.40% 0.74% 31.60% NA
Indica I  595 89.60% 2.70% 0.17% 7.56% NA
Indica II  465 52.70% 2.20% 0.43% 44.73% NA
Indica III  913 56.30% 1.00% 0.88% 41.84% NA
Indica Intermediate  786 58.50% 6.40% 0.64% 34.48% NA
Temperate Japonica  767 1.40% 98.00% 0.00% 0.52% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 32.40% 67.20% 0.00% 0.41% NA
VI/Aromatic  96 22.90% 68.80% 1.04% 7.29% NA
Intermediate  90 34.40% 56.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218169215 A -> DEL N N silent_mutation Average:43.947; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1218169215 A -> G LOC_Os12g30280.1 upstream_gene_variant ; 3466.0bp to feature; MODIFIER silent_mutation Average:43.947; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1218169215 A -> G LOC_Os12g30290.1 upstream_gene_variant ; 171.0bp to feature; MODIFIER silent_mutation Average:43.947; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1218169215 A -> G LOC_Os12g30290-LOC_Os12g30310 intergenic_region ; MODIFIER silent_mutation Average:43.947; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218169215 6.01E-08 NA mr1030 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 5.28E-07 9.16E-08 mr1030 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 3.46E-06 NA mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 4.00E-06 NA mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 3.56E-06 NA mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 5.27E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 5.41E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 3.73E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 4.30E-06 NA mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 8.64E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 1.65E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 4.17E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.10E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.86E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 7.73E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 1.30E-06 7.01E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 3.06E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 4.66E-08 NA mr1358 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 4.47E-06 NA mr1406 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 7.94E-10 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 5.59E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 3.48E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 4.61E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 4.68E-08 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 3.47E-06 NA mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 1.86E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 3.46E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 6.11E-06 NA mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 6.16E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 2.42E-07 NA mr1614 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.00E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 3.97E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 6.99E-10 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 4.38E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 8.01E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 1.22E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.56E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.49E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 4.40E-06 NA mr1715 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 3.08E-06 NA mr1715 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 1.26E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 3.61E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 6.47E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 4.49E-06 8.02E-12 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.14E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 2.09E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 8.42E-07 NA mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 3.72E-06 5.16E-07 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169215 NA 1.31E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251