\
| Variant ID: vg1218169210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18169210 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 86. )
GTCTCAAAGTTGTGAGAAAGATCCTGCAACTTGTAAGGTCGTGAGACCTAGATTTGTGAATTGGGCGTTATGTGACTCCTGTCGGTGAAGTGCGTTGAAT[C/A]
CCACACTCCTAGCAGGCGTAGAGTTCAGCTTTCACGTGGAGTATCACCGGGCAATCCTCGAGAATATACTTGGATGTCAGCTTTTAGGTAGTATTCCTTG
CAAGGAATACTACCTAAAAGCTGACATCCAAGTATATTCTCGAGGATTGCCCGGTGATACTCCACGTGAAAGCTGAACTCTACGCCTGCTAGGAGTGTGG[G/T]
ATTCAACGCACTTCACCGACAGGAGTCACATAACGCCCAATTCACAAATCTAGGTCTCACGACCTTACAAGTTGCAGGATCTTTCTCACAACTTTGAGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.20% | 37.30% | 3.60% | 15.85% | NA |
| All Indica | 2759 | 15.70% | 54.90% | 5.84% | 23.56% | NA |
| All Japonica | 1512 | 90.50% | 9.20% | 0.07% | 0.26% | NA |
| Aus | 269 | 36.10% | 31.60% | 1.49% | 30.86% | NA |
| Indica I | 595 | 3.50% | 89.10% | 1.51% | 5.88% | NA |
| Indica II | 465 | 29.90% | 33.80% | 11.18% | 25.16% | NA |
| Indica III | 913 | 14.80% | 47.20% | 6.24% | 31.76% | NA |
| Indica Intermediate | 786 | 17.40% | 50.60% | 5.47% | 26.46% | NA |
| Temperate Japonica | 767 | 98.30% | 1.20% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 10.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 83.30% | 8.30% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 72.20% | 18.90% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218169210 | C -> DEL | N | N | silent_mutation | Average:44.479; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg1218169210 | C -> A | LOC_Os12g30280.1 | upstream_gene_variant ; 3461.0bp to feature; MODIFIER | silent_mutation | Average:44.479; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg1218169210 | C -> A | LOC_Os12g30290.1 | upstream_gene_variant ; 166.0bp to feature; MODIFIER | silent_mutation | Average:44.479; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg1218169210 | C -> A | LOC_Os12g30290-LOC_Os12g30310 | intergenic_region ; MODIFIER | silent_mutation | Average:44.479; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218169210 | 8.96E-06 | NA | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 1.05E-06 | 1.17E-08 | mr1030 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.42E-07 | mr1031 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 3.98E-06 | 3.98E-06 | mr1046 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.11E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 6.06E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 7.41E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.43E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.64E-07 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.03E-09 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 1.58E-06 | NA | mr1176 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 8.00E-07 | NA | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.88E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.44E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.46E-06 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 6.51E-08 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.02E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 1.25E-07 | 8.11E-09 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 9.04E-07 | 5.44E-06 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 6.91E-07 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 3.94E-06 | 3.94E-06 | mr1331 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 3.37E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 8.36E-07 | 1.77E-08 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 4.30E-06 | 2.44E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 8.78E-08 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 2.64E-06 | NA | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.07E-06 | mr1425 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 4.54E-07 | mr1425 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 3.62E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 1.08E-06 | 7.94E-09 | mr1446 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 8.03E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.28E-07 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.19E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 8.61E-06 | 8.61E-06 | mr1513 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 6.05E-07 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 8.69E-06 | 1.99E-06 | mr1520 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 3.68E-06 | 1.27E-06 | mr1522 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 5.96E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.01E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.45E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.85E-06 | mr1614 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 5.35E-06 | 1.99E-07 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 1.23E-06 | 1.84E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 3.46E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.48E-07 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 9.39E-06 | 8.39E-13 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 4.77E-06 | 1.14E-08 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 6.75E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 8.34E-06 | mr1684 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.01E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 8.54E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.98E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 3.82E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 3.50E-06 | mr1749 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 7.73E-06 | 8.79E-06 | mr1768 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 4.88E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 5.32E-06 | mr1835 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.31E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 8.92E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 2.95E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 1.90E-06 | mr1958 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 2.86E-06 | NA | mr1965 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 5.39E-08 | 4.63E-10 | mr1965 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | 9.59E-06 | 9.59E-06 | mr1966 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169210 | NA | 5.28E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |