\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218168882:

Variant ID: vg1218168882 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18168882
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTCTCGCAGCCGCATAGCCCATTGGTTGACGTCGGGGTTCGTGACCGGGTCGAAAGGACTTTCACTCAATATCGCATCTAAGGTTCGTAGCTGCTGAG[T/C]
GAGTGTTCTCGCTGCTGTGGACGCGCTTGTTTCAGTGTTGTCAACCACGTTTACATCCCGTGGTGACTCCGAATAGGACTCGTAGTCTTCCAGGAGGTGT

Reverse complement sequence

ACACCTCCTGGAAGACTACGAGTCCTATTCGGAGTCACCACGGGATGTAAACGTGGTTGACAACACTGAAACAAGCGCGTCCACAGCAGCGAGAACACTC[A/G]
CTCAGCAGCTACGAACCTTAGATGCGATATTGAGTGAAAGTCCTTTCGACCCGGTCACGAACCCCGACGTCAACCAATGGGCTATGCGGCTGCGAGAGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 36.50% 2.05% 20.00% NA
All Indica  2759 61.70% 4.50% 3.30% 30.55% NA
All Japonica  1512 9.40% 90.30% 0.00% 0.33% NA
Aus  269 32.00% 35.70% 1.12% 31.23% NA
Indica I  595 89.10% 3.00% 0.50% 7.39% NA
Indica II  465 52.50% 2.80% 3.66% 41.08% NA
Indica III  913 53.00% 3.60% 4.60% 38.77% NA
Indica Intermediate  786 56.50% 7.50% 3.69% 32.32% NA
Temperate Japonica  767 1.20% 98.30% 0.00% 0.52% NA
Tropical Japonica  504 20.80% 79.20% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 88.00% 0.00% 0.41% NA
VI/Aromatic  96 8.30% 83.30% 2.08% 6.25% NA
Intermediate  90 24.40% 66.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218168882 T -> C LOC_Os12g30290.1 missense_variant ; p.Thr55Ala; MODERATE nonsynonymous_codon ; T55A Average:50.014; most accessible tissue: Zhenshan97 young leaf, score: 72.34 unknown unknown TOLERATED 1.00
vg1218168882 T -> DEL LOC_Os12g30290.1 N frameshift_variant Average:50.014; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218168882 6.18E-06 4.36E-07 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 7.59E-07 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 4.10E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 9.14E-06 NA mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 2.73E-07 2.19E-08 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 7.57E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 4.40E-07 8.16E-07 mr1325 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 2.00E-06 NA mr1326 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 3.19E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.11E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 6.40E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 2.32E-06 1.05E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 8.92E-06 2.26E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 2.24E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 5.69E-07 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 3.82E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 2.80E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 6.20E-06 2.42E-08 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 3.47E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.35E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 3.53E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.22E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 7.44E-06 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 2.11E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 2.61E-06 6.88E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.28E-10 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.51E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 7.32E-06 1.01E-08 mr1686 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 9.14E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.05E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 1.56E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 7.77E-06 NA mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 1.60E-07 9.96E-09 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 7.11E-06 7.11E-06 mr1966 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168882 NA 4.38E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251