Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218168761:

Variant ID: vg1218168761 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18168761
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

ACCGGAGGGACGTGTCCCGTTGGGATTTTCTCCGTTTGCATCTCCTGCGGTTGGTCCTCCGTCCTCATGCTGCTCCGGGTTGACAGCTGCTTCGGCAAAT[G/A]
CGACATTGAGGTTAGTCATTGTCTCTCGCAGCCGCATAGCCCATTGGTTGACGTCGGGGTTCGTGACCGGGTCGAAAGGACTTTCACTCAATATCGCATC

Reverse complement sequence

GATGCGATATTGAGTGAAAGTCCTTTCGACCCGGTCACGAACCCCGACGTCAACCAATGGGCTATGCGGCTGCGAGAGACAATGACTAACCTCAATGTCG[C/T]
ATTTGCCGAAGCAGCTGTCAACCCGGAGCAGCATGAGGACGGAGGACCAACCGCAGGAGATGCAAACGGAGAAAATCCCAACGGGACACGTCCCTCCGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	31.00%	0.72%	21.07%	NA
All Indica	2759	21.20%	45.30%	1.05%	32.44%	NA
All Japonica	1512	91.50%	8.10%	0.00%	0.33%	NA
Aus	269	43.10%	24.90%	1.49%	30.48%	NA
Indica I	595	10.60%	81.70%	0.17%	7.56%	NA
Indica II	465	30.10%	25.60%	0.86%	43.44%	NA
Indica III	913	23.40%	33.40%	1.20%	41.95%	NA
Indica Intermediate	786	21.20%	43.40%	1.65%	33.72%	NA
Temperate Japonica	767	99.10%	0.40%	0.00%	0.52%	NA
Tropical Japonica	504	79.80%	20.20%	0.00%	0.00%	NA
Japonica Intermediate	241	92.10%	7.50%	0.00%	0.41%	NA
VI/Aromatic	96	83.30%	8.30%	1.04%	7.29%	NA
Intermediate	90	75.60%	16.70%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218168761	G -> DEL	LOC_Os12g30290.1	N	frameshift_variant	Average:59.533; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg1218168761	G -> A	LOC_Os12g30290.1	missense_variant ; p.Ala95Val; MODERATE	nonsynonymous_codon ; A95V	Average:59.533; most accessible tissue: Zhenshan97 young leaf, score: 78.644	unknown	unknown	TOLERATED	0.09

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218168761	NA	5.60E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	7.56E-07	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	9.92E-06	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	1.68E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	6.90E-06	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	1.76E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	3.76E-08	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	4.45E-06	3.67E-07	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	5.76E-06	NA	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	3.50E-06	8.48E-08	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	2.72E-06	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	1.40E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	1.40E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	3.46E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	9.67E-06	9.67E-06	mr1513	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	8.94E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	6.11E-07	NA	mr1519	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	5.82E-06	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	5.22E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	2.11E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	7.31E-11	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	3.09E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	3.42E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	1.42E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	6.87E-06	mr1755	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	5.97E-06	1.72E-06	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	3.89E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	2.34E-06	mr1884	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	6.15E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	3.98E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168761	NA	1.95E-07	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251