\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218168020:

Variant ID: vg1218168020 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18168020
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCGATGATGAGATCGAGCGGGACGGGAGATGGACCAGCCATGAACGAGTAGATCCCTTCAACGCAGCTGGCAAGTAATTTGCCAGCATGTTGTTGTCT[G/A]
CGCTAGCGGCATAGAGGATTGTGGAGTAGACTTGCAGAAATTCTTCCGGATCTGTGCTTCCATCGTACTTCTCTATTGCACCTGGTCGGAACTTCTCGGG

Reverse complement sequence

CCCGAGAAGTTCCGACCAGGTGCAATAGAGAAGTACGATGGAAGCACAGATCCGGAAGAATTTCTGCAAGTCTACTCCACAATCCTCTATGCCGCTAGCG[C/T]
AGACAACAACATGCTGGCAAATTACTTGCCAGCTGCGTTGAAGGGATCTACTCGTTCATGGCTGGTCCATCTCCCGTCCCGCTCGATCTCATCATCGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 23.10% 10.24% 27.55% NA
All Indica  2759 12.90% 26.80% 17.07% 43.17% NA
All Japonica  1512 85.80% 13.50% 0.13% 0.53% NA
Aus  269 24.50% 41.60% 1.12% 32.71% NA
Indica I  595 2.90% 23.40% 39.66% 34.12% NA
Indica II  465 25.80% 24.50% 5.59% 44.09% NA
Indica III  913 11.30% 32.20% 9.53% 46.99% NA
Indica Intermediate  786 14.90% 24.60% 15.52% 45.04% NA
Temperate Japonica  767 98.20% 1.00% 0.13% 0.65% NA
Tropical Japonica  504 75.40% 24.00% 0.20% 0.40% NA
Japonica Intermediate  241 68.50% 31.10% 0.00% 0.41% NA
VI/Aromatic  96 68.80% 21.90% 2.08% 7.29% NA
Intermediate  90 67.80% 16.70% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218168020 G -> DEL LOC_Os12g30290.1 N frameshift_variant Average:51.87; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218168020 G -> A LOC_Os12g30290.1 missense_variant ; p.Ala342Val; MODERATE nonsynonymous_codon ; A342I Average:51.87; most accessible tissue: Zhenshan97 young leaf, score: 70.625 possibly damaging 1.638 DELETERIOUS 0.01
vg1218168020 G -> A LOC_Os12g30290.1 missense_variant ; p.Ala342Val; MODERATE nonsynonymous_codon ; A342V Average:51.87; most accessible tissue: Zhenshan97 young leaf, score: 70.625 benign 0.593 TOLERATED 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218168020 1.95E-06 NA mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 2.00E-07 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 7.00E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 4.68E-06 NA mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 7.21E-06 7.20E-06 mr1046 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 4.03E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 3.13E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 3.10E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 1.23E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.90E-06 mr1268 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 9.13E-06 1.41E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 1.41E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 4.30E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 5.15E-06 NA mr1426 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 3.11E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 5.01E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 4.69E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.68E-08 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.63E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 5.77E-06 NA mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.16E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.99E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 4.31E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 5.79E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 2.88E-06 2.88E-06 mr1666 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.95E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 4.76E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 1.41E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.47E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 2.33E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 1.79E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 6.20E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 3.58E-09 mr1881 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 8.48E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 9.20E-07 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020 NA 5.36E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251