Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218168020:

Variant ID: vg1218168020 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18168020
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCGATGATGAGATCGAGCGGGACGGGAGATGGACCAGCCATGAACGAGTAGATCCCTTCAACGCAGCTGGCAAGTAATTTGCCAGCATGTTGTTGTCT[G/A]
CGCTAGCGGCATAGAGGATTGTGGAGTAGACTTGCAGAAATTCTTCCGGATCTGTGCTTCCATCGTACTTCTCTATTGCACCTGGTCGGAACTTCTCGGG

Reverse complement sequence

CCCGAGAAGTTCCGACCAGGTGCAATAGAGAAGTACGATGGAAGCACAGATCCGGAAGAATTTCTGCAAGTCTACTCCACAATCCTCTATGCCGCTAGCG[C/T]
AGACAACAACATGCTGGCAAATTACTTGCCAGCTGCGTTGAAGGGATCTACTCGTTCATGGCTGGTCCATCTCCCGTCCCGCTCGATCTCATCATCGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	23.10%	10.24%	27.55%	NA
All Indica	2759	12.90%	26.80%	17.07%	43.17%	NA
All Japonica	1512	85.80%	13.50%	0.13%	0.53%	NA
Aus	269	24.50%	41.60%	1.12%	32.71%	NA
Indica I	595	2.90%	23.40%	39.66%	34.12%	NA
Indica II	465	25.80%	24.50%	5.59%	44.09%	NA
Indica III	913	11.30%	32.20%	9.53%	46.99%	NA
Indica Intermediate	786	14.90%	24.60%	15.52%	45.04%	NA
Temperate Japonica	767	98.20%	1.00%	0.13%	0.65%	NA
Tropical Japonica	504	75.40%	24.00%	0.20%	0.40%	NA
Japonica Intermediate	241	68.50%	31.10%	0.00%	0.41%	NA
VI/Aromatic	96	68.80%	21.90%	2.08%	7.29%	NA
Intermediate	90	67.80%	16.70%	6.67%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218168020	G -> DEL	LOC_Os12g30290.1	N	frameshift_variant	Average:51.87; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218168020	G -> A	LOC_Os12g30290.1	missense_variant ; p.Ala342Val; MODERATE	nonsynonymous_codon ; A342I	Average:51.87; most accessible tissue: Zhenshan97 young leaf, score: 70.625	possibly damaging	1.638	DELETERIOUS	0.01
vg1218168020	G -> A	LOC_Os12g30290.1	missense_variant ; p.Ala342Val; MODERATE	nonsynonymous_codon ; A342V	Average:51.87; most accessible tissue: Zhenshan97 young leaf, score: 70.625	benign	0.593	TOLERATED	0.13

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218168020	1.95E-06	NA	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	2.00E-07	mr1030	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	7.00E-07	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	4.68E-06	NA	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	7.21E-06	7.20E-06	mr1046	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	4.03E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	3.13E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	3.10E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	1.23E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.90E-06	mr1268	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	9.13E-06	1.41E-11	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	1.41E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	4.30E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	5.15E-06	NA	mr1426	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	3.11E-09	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	5.01E-07	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	4.69E-07	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.68E-08	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.63E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	5.77E-06	NA	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.16E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.99E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	4.31E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	5.79E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	2.88E-06	2.88E-06	mr1666	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.95E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	4.76E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	1.41E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.47E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	2.33E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	1.79E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	6.20E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	3.58E-09	mr1881	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	8.48E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	9.20E-07	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218168020	NA	5.36E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251