\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218167970:

Variant ID: vg1218167970 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18167970
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCGTTTGTAGGTTCCCTGGAAGTTGGCGACGAACTGCTGCCACAAGTCTTCCGATGATGAGATCGAGCGGGACGGGAGATGGACCAGCCATGAACGAG[T/C]
AGATCCCTTCAACGCAGCTGGCAAGTAATTTGCCAGCATGTTGTTGTCTGCGCTAGCGGCATAGAGGATTGTGGAGTAGACTTGCAGAAATTCTTCCGGA

Reverse complement sequence

TCCGGAAGAATTTCTGCAAGTCTACTCCACAATCCTCTATGCCGCTAGCGCAGACAACAACATGCTGGCAAATTACTTGCCAGCTGCGTTGAAGGGATCT[A/G]
CTCGTTCATGGCTGGTCCATCTCCCGTCCCGCTCGATCTCATCATCGGAAGACTTGTGGCAGCAGTTCGTCGCCAACTTCCAGGGAACCTACAAACGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 30.20% 16.67% 20.74% NA
All Indica  2759 3.60% 36.80% 27.08% 32.51% NA
All Japonica  1512 85.60% 13.60% 0.33% 0.46% NA
Aus  269 7.40% 60.60% 8.55% 23.42% NA
Indica I  595 3.20% 24.50% 44.54% 27.73% NA
Indica II  465 2.40% 45.80% 21.08% 30.75% NA
Indica III  913 1.50% 44.20% 19.39% 34.83% NA
Indica Intermediate  786 7.00% 32.20% 26.34% 34.48% NA
Temperate Japonica  767 98.00% 1.20% 0.26% 0.52% NA
Tropical Japonica  504 75.20% 24.00% 0.40% 0.40% NA
Japonica Intermediate  241 67.60% 31.50% 0.41% 0.41% NA
VI/Aromatic  96 67.70% 22.90% 4.17% 5.21% NA
Intermediate  90 58.90% 22.20% 10.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218167970 T -> C LOC_Os12g30290.1 missense_variant ; p.Thr359Ala; MODERATE nonsynonymous_codon ; T359D Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16 possibly damaging 1.526 DELETERIOUS 0.00
vg1218167970 T -> C LOC_Os12g30290.1 missense_variant ; p.Thr359Ala; MODERATE nonsynonymous_codon ; T359G Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16 benign 0.993 DELETERIOUS 0.02
vg1218167970 T -> C LOC_Os12g30290.1 missense_variant ; p.Thr359Ala; MODERATE nonsynonymous_codon ; T359V Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16 benign 1.007 DELETERIOUS 0.01
vg1218167970 T -> C LOC_Os12g30290.1 missense_variant ; p.Thr359Ala; MODERATE nonsynonymous_codon ; T359A Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16 benign -0.383 TOLERATED 1.00
vg1218167970 T -> DEL LOC_Os12g30290.1 N frameshift_variant Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218167970 NA 5.83E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 6.56E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 7.18E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 9.71E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 6.28E-06 NA mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.06E-12 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 2.37E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.43E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 3.72E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 2.26E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 6.52E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.98E-17 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 4.26E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 7.22E-06 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.61E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 7.93E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 6.61E-07 NA mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.98E-17 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 4.03E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 4.20E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 3.73E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 3.98E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 6.16E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.91E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 3.73E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 5.12E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.52E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 7.13E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 7.89E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 7.85E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 6.47E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 9.69E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 8.77E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 4.46E-07 NA mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 5.41E-08 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 3.72E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 1.07E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 2.45E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 6.93E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 4.74E-06 8.60E-24 mr1943 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970 NA 9.93E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251