Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218167970:

Variant ID: vg1218167970 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18167970
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCGTTTGTAGGTTCCCTGGAAGTTGGCGACGAACTGCTGCCACAAGTCTTCCGATGATGAGATCGAGCGGGACGGGAGATGGACCAGCCATGAACGAG[T/C]
AGATCCCTTCAACGCAGCTGGCAAGTAATTTGCCAGCATGTTGTTGTCTGCGCTAGCGGCATAGAGGATTGTGGAGTAGACTTGCAGAAATTCTTCCGGA

Reverse complement sequence

TCCGGAAGAATTTCTGCAAGTCTACTCCACAATCCTCTATGCCGCTAGCGCAGACAACAACATGCTGGCAAATTACTTGCCAGCTGCGTTGAAGGGATCT[A/G]
CTCGTTCATGGCTGGTCCATCTCCCGTCCCGCTCGATCTCATCATCGGAAGACTTGTGGCAGCAGTTCGTCGCCAACTTCCAGGGAACCTACAAACGCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.40%	30.20%	16.67%	20.74%	NA
All Indica	2759	3.60%	36.80%	27.08%	32.51%	NA
All Japonica	1512	85.60%	13.60%	0.33%	0.46%	NA
Aus	269	7.40%	60.60%	8.55%	23.42%	NA
Indica I	595	3.20%	24.50%	44.54%	27.73%	NA
Indica II	465	2.40%	45.80%	21.08%	30.75%	NA
Indica III	913	1.50%	44.20%	19.39%	34.83%	NA
Indica Intermediate	786	7.00%	32.20%	26.34%	34.48%	NA
Temperate Japonica	767	98.00%	1.20%	0.26%	0.52%	NA
Tropical Japonica	504	75.20%	24.00%	0.40%	0.40%	NA
Japonica Intermediate	241	67.60%	31.50%	0.41%	0.41%	NA
VI/Aromatic	96	67.70%	22.90%	4.17%	5.21%	NA
Intermediate	90	58.90%	22.20%	10.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218167970	T -> C	LOC_Os12g30290.1	missense_variant ; p.Thr359Ala; MODERATE	nonsynonymous_codon ; T359D	Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16	possibly damaging	1.526	DELETERIOUS	0.00
vg1218167970	T -> C	LOC_Os12g30290.1	missense_variant ; p.Thr359Ala; MODERATE	nonsynonymous_codon ; T359G	Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16	benign	0.993	DELETERIOUS	0.02
vg1218167970	T -> C	LOC_Os12g30290.1	missense_variant ; p.Thr359Ala; MODERATE	nonsynonymous_codon ; T359V	Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16	benign	1.007	DELETERIOUS	0.01
vg1218167970	T -> C	LOC_Os12g30290.1	missense_variant ; p.Thr359Ala; MODERATE	nonsynonymous_codon ; T359A	Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16	benign	-0.383	TOLERATED	1.00
vg1218167970	T -> DEL	LOC_Os12g30290.1	N	frameshift_variant	Average:51.412; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218167970	NA	5.83E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	6.56E-07	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	7.18E-22	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	9.71E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	6.28E-06	NA	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.06E-12	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	2.37E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.43E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	3.72E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	2.26E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	6.52E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.98E-17	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	4.26E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	7.22E-06	mr1407	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.61E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	7.93E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	6.61E-07	NA	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.98E-17	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	4.03E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	4.20E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	3.73E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	3.98E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	6.16E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.91E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	3.73E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	5.12E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.52E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	7.13E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	7.89E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	7.85E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	6.47E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	9.69E-20	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	8.77E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	4.46E-07	NA	mr1876	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	5.41E-08	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	3.72E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	1.07E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	2.45E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	6.93E-15	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	4.74E-06	8.60E-24	mr1943	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218167970	NA	9.93E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251