\
| Variant ID: vg1218165645 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18165645 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 90. )
ACTCAGAATCTCCTTTTACGATTAGTCGCTTAGCACCGAGTGCAGCTGCTGCTCTTATTCCCGCGAGTAGGCCTTCGTACTCGACCGTGTTGTTTGTTGC[C/T]
CGGAAGTTGAGGTGGATTGCATGGTTGAATTGATCTCCGGAAGGAGATGTCAAGATGAACCCGGCTCCCGCTCCTTGGCTGTTGAGTGTGCCGTCGAACG
CGTTCGACGGCACACTCAACAGCCAAGGAGCGGGAGCCGGGTTCATCTTGACATCTCCTTCCGGAGATCAATTCAACCATGCAATCCACCTCAACTTCCG[G/A]
GCAACAAACAACACGGTCGAGTACGAAGGCCTACTCGCGGGAATAAGAGCAGCAGCTGCACTCGGTGCTAAGCGACTAATCGTAAAAGGAGATTCTGAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.90% | 37.10% | 2.81% | 13.22% | NA |
| All Indica | 2759 | 20.90% | 54.50% | 4.60% | 19.97% | NA |
| All Japonica | 1512 | 90.50% | 9.10% | 0.00% | 0.33% | NA |
| Aus | 269 | 45.00% | 32.00% | 1.49% | 21.56% | NA |
| Indica I | 595 | 4.70% | 89.10% | 0.17% | 6.05% | NA |
| Indica II | 465 | 41.50% | 32.90% | 3.87% | 21.72% | NA |
| Indica III | 913 | 18.90% | 47.50% | 7.23% | 26.29% | NA |
| Indica Intermediate | 786 | 23.30% | 49.20% | 5.34% | 22.14% | NA |
| Temperate Japonica | 767 | 98.30% | 1.20% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 85.40% | 8.30% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 75.60% | 16.70% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218165645 | C -> DEL | LOC_Os12g30280.1 | N | frameshift_variant | Average:43.477; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | N | N | N | N |
| vg1218165645 | C -> T | LOC_Os12g30280.1 | synonymous_variant ; p.Arg35Arg; LOW | synonymous_codon | Average:43.477; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218165645 | NA | 6.92E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 8.55E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 1.37E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 1.51E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 3.81E-06 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 7.35E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | 1.10E-06 | NA | mr1295 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | 6.95E-06 | 1.49E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 4.44E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 1.44E-06 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 6.47E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 3.99E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 6.41E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 5.55E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 3.92E-06 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 5.36E-11 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 1.09E-06 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 7.88E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 4.00E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218165645 | NA | 4.22E-07 | mr1965 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |