\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218165645:

Variant ID: vg1218165645 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18165645
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCAGAATCTCCTTTTACGATTAGTCGCTTAGCACCGAGTGCAGCTGCTGCTCTTATTCCCGCGAGTAGGCCTTCGTACTCGACCGTGTTGTTTGTTGC[C/T]
CGGAAGTTGAGGTGGATTGCATGGTTGAATTGATCTCCGGAAGGAGATGTCAAGATGAACCCGGCTCCCGCTCCTTGGCTGTTGAGTGTGCCGTCGAACG

Reverse complement sequence

CGTTCGACGGCACACTCAACAGCCAAGGAGCGGGAGCCGGGTTCATCTTGACATCTCCTTCCGGAGATCAATTCAACCATGCAATCCACCTCAACTTCCG[G/A]
GCAACAAACAACACGGTCGAGTACGAAGGCCTACTCGCGGGAATAAGAGCAGCAGCTGCACTCGGTGCTAAGCGACTAATCGTAAAAGGAGATTCTGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 37.10% 2.81% 13.22% NA
All Indica  2759 20.90% 54.50% 4.60% 19.97% NA
All Japonica  1512 90.50% 9.10% 0.00% 0.33% NA
Aus  269 45.00% 32.00% 1.49% 21.56% NA
Indica I  595 4.70% 89.10% 0.17% 6.05% NA
Indica II  465 41.50% 32.90% 3.87% 21.72% NA
Indica III  913 18.90% 47.50% 7.23% 26.29% NA
Indica Intermediate  786 23.30% 49.20% 5.34% 22.14% NA
Temperate Japonica  767 98.30% 1.20% 0.00% 0.52% NA
Tropical Japonica  504 79.40% 20.60% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.40% 0.00% 0.41% NA
VI/Aromatic  96 85.40% 8.30% 0.00% 6.25% NA
Intermediate  90 75.60% 16.70% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218165645 C -> DEL LOC_Os12g30280.1 N frameshift_variant Average:43.477; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg1218165645 C -> T LOC_Os12g30280.1 synonymous_variant ; p.Arg35Arg; LOW synonymous_codon Average:43.477; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218165645 NA 6.92E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 8.55E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 1.37E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 1.51E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 3.81E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 7.35E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 1.10E-06 NA mr1295 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 6.95E-06 1.49E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 4.44E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 1.44E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 6.47E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 3.99E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 6.41E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 5.55E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 3.92E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 5.36E-11 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 1.09E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 7.88E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 4.00E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165645 NA 4.22E-07 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251