\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218164873:

Variant ID: vg1218164873 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18164873
Reference Allele: TAlternative Allele: C,TGC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.44, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAACATGAATATGTAGCCCCCTTGTCCTCGTGGGAATGTTCCGAGTATATCGAGCCCCCAGCATGAGAACGGCCATGTCAAAGGGATAGTCTGGAGCA[T/C,TGC]
TTGTGCTGGCAACTTGGTATGTTTGCTAAAGAACTGGCAAGCTTCAAATCATTGCACAATGTCACAGGCGTCTTTTAAGGCTGTTGGTTAGAAAAACCCT

Reverse complement sequence

AGGGTTTTTCTAACCAACAGCCTTAAAAGACGCCTGTGACATTGTGCAATGATTTGAAGCTTGCCAGTTCTTTAGCAAACATACCAAGTTGCCAGCACAA[A/G,GCA]
TGCTCCAGACTATCCCTTTGACATGGCCGTTCTCATGCTGGGGGCTCGATATACTCGGAACATTCCCACGAGGACAAGGGGGCTACATATTCATGTTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 32.00% 0.76% 24.80% TGC: 0.17%
All Indica  2759 57.20% 3.40% 0.98% 38.13% TGC: 0.29%
All Japonica  1512 13.80% 84.90% 0.46% 0.86% NA
Aus  269 59.90% 7.10% 0.37% 32.71% NA
Indica I  595 89.10% 2.90% 0.17% 7.90% NA
Indica II  465 36.80% 2.40% 1.29% 59.14% TGC: 0.43%
Indica III  913 51.90% 1.80% 1.10% 45.13% TGC: 0.11%
Indica Intermediate  786 51.10% 6.50% 1.27% 40.46% TGC: 0.64%
Temperate Japonica  767 1.40% 96.50% 0.65% 1.43% NA
Tropical Japonica  504 24.40% 75.60% 0.00% 0.00% NA
Japonica Intermediate  241 31.10% 67.20% 0.83% 0.83% NA
VI/Aromatic  96 22.90% 68.80% 0.00% 8.33% NA
Intermediate  90 32.20% 54.40% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218164873 T -> C LOC_Os12g30270.1 downstream_gene_variant ; 1723.0bp to feature; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> C LOC_Os12g30280.1 downstream_gene_variant ; 88.0bp to feature; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> C LOC_Os12g30290.1 downstream_gene_variant ; 1266.0bp to feature; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> C LOC_Os12g30270-LOC_Os12g30280 intergenic_region ; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> DEL N N silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> TGC LOC_Os12g30270.1 downstream_gene_variant ; 1724.0bp to feature; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> TGC LOC_Os12g30280.1 downstream_gene_variant ; 87.0bp to feature; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> TGC LOC_Os12g30290.1 downstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1218164873 T -> TGC LOC_Os12g30270-LOC_Os12g30280 intergenic_region ; MODIFIER silent_mutation Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218164873 NA 8.21E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 3.95E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 5.42E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 8.20E-06 mr1284 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 2.92E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 2.40E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 6.16E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 1.35E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 9.31E-11 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 8.55E-06 8.55E-06 mr1666 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 8.43E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 7.82E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 1.73E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 4.21E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 6.47E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 1.42E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 9.55E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 7.52E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 3.75E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 1.57E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 9.72E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873 NA 7.40E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251