Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218164873:

Variant ID: vg1218164873 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 18164873
Reference Allele: T	Alternative Allele: C,TGC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.44, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ACGAACATGAATATGTAGCCCCCTTGTCCTCGTGGGAATGTTCCGAGTATATCGAGCCCCCAGCATGAGAACGGCCATGTCAAAGGGATAGTCTGGAGCA[T/C,TGC]
TTGTGCTGGCAACTTGGTATGTTTGCTAAAGAACTGGCAAGCTTCAAATCATTGCACAATGTCACAGGCGTCTTTTAAGGCTGTTGGTTAGAAAAACCCT

Reverse complement sequence

AGGGTTTTTCTAACCAACAGCCTTAAAAGACGCCTGTGACATTGTGCAATGATTTGAAGCTTGCCAGTTCTTTAGCAAACATACCAAGTTGCCAGCACAA[A/G,GCA]
TGCTCCAGACTATCCCTTTGACATGGCCGTTCTCATGCTGGGGGCTCGATATACTCGGAACATTCCCACGAGGACAAGGGGGCTACATATTCATGTTCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	32.00%	0.76%	24.80%	TGC: 0.17%
All Indica	2759	57.20%	3.40%	0.98%	38.13%	TGC: 0.29%
All Japonica	1512	13.80%	84.90%	0.46%	0.86%	NA
Aus	269	59.90%	7.10%	0.37%	32.71%	NA
Indica I	595	89.10%	2.90%	0.17%	7.90%	NA
Indica II	465	36.80%	2.40%	1.29%	59.14%	TGC: 0.43%
Indica III	913	51.90%	1.80%	1.10%	45.13%	TGC: 0.11%
Indica Intermediate	786	51.10%	6.50%	1.27%	40.46%	TGC: 0.64%
Temperate Japonica	767	1.40%	96.50%	0.65%	1.43%	NA
Tropical Japonica	504	24.40%	75.60%	0.00%	0.00%	NA
Japonica Intermediate	241	31.10%	67.20%	0.83%	0.83%	NA
VI/Aromatic	96	22.90%	68.80%	0.00%	8.33%	NA
Intermediate	90	32.20%	54.40%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218164873	T -> C	LOC_Os12g30270.1	downstream_gene_variant ; 1723.0bp to feature; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> C	LOC_Os12g30280.1	downstream_gene_variant ; 88.0bp to feature; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> C	LOC_Os12g30290.1	downstream_gene_variant ; 1266.0bp to feature; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> C	LOC_Os12g30270-LOC_Os12g30280	intergenic_region ; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> DEL	N	N	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> TGC	LOC_Os12g30270.1	downstream_gene_variant ; 1724.0bp to feature; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> TGC	LOC_Os12g30280.1	downstream_gene_variant ; 87.0bp to feature; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> TGC	LOC_Os12g30290.1	downstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1218164873	T -> TGC	LOC_Os12g30270-LOC_Os12g30280	intergenic_region ; MODIFIER	silent_mutation	Average:36.245; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218164873	NA	8.21E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	3.95E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	5.42E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	8.20E-06	mr1284	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	2.92E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	2.40E-07	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	6.16E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	1.35E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	9.31E-11	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	8.55E-06	8.55E-06	mr1666	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	8.43E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	7.82E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	1.73E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	4.21E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	6.47E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	1.42E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	9.55E-06	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	7.52E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	3.75E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	1.57E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	9.72E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218164873	NA	7.40E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251