\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218162333:

Variant ID: vg1218162333 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18162333
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCGGAGTGTGGCGTGAAGTCTTCCGTCTCTGCGCACCCTAACGTGACCTCTCTGACATCGGTGCTTGGCGAATTGGCAACAAAGATGGAGGCCATCCC[G/A]
TCGAAGCATGTCGCCAGGGTCTTGGAGGAGATCTGCAACGGGATCCACACTGGGGTTTGTCATGTCCTCTCTTGTGTGAAGCTAGCTCTCCCCAACGTCG

Reverse complement sequence

CGACGTTGGGGAGAGCTAGCTTCACACAAGAGAGGACATGACAAACCCCAGTGTGGATCCCGTTGCAGATCTCCTCCAAGACCCTGGCGACATGCTTCGA[C/T]
GGGATGGCCTCCATCTTTGTTGCCAATTCGCCAAGCACCGATGTCAGAGAGGTCACGTTAGGGTGCGCAGAGACGGAAGACTTCACGCCACACTCCGGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 31.10% 1.44% 23.83% NA
All Indica  2759 40.40% 20.50% 2.39% 36.75% NA
All Japonica  1512 50.80% 48.80% 0.00% 0.40% NA
Aus  269 26.00% 40.90% 0.37% 32.71% NA
Indica I  595 83.40% 8.70% 0.17% 7.73% NA
Indica II  465 14.20% 22.20% 4.52% 59.14% NA
Indica III  913 25.00% 29.40% 3.07% 42.61% NA
Indica Intermediate  786 41.20% 18.10% 2.04% 38.68% NA
Temperate Japonica  767 36.60% 62.80% 0.00% 0.52% NA
Tropical Japonica  504 74.00% 26.00% 0.00% 0.00% NA
Japonica Intermediate  241 47.30% 51.90% 0.00% 0.83% NA
VI/Aromatic  96 67.70% 24.00% 0.00% 8.33% NA
Intermediate  90 50.00% 37.80% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218162333 G -> DEL LOC_Os12g30270.1 N frameshift_variant Average:50.271; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg1218162333 G -> A LOC_Os12g30270.1 synonymous_variant ; p.Pro297Pro; LOW synonymous_codon Average:50.271; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218162333 NA 3.41E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 1.83E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 2.89E-09 5.06E-11 mr1060 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 3.95E-06 2.15E-07 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 8.88E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 8.71E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 3.51E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 3.09E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 9.25E-06 9.21E-06 mr1267 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 8.30E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 8.29E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 8.43E-07 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.27E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 1.46E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.23E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 7.02E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.76E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 2.89E-06 1.30E-08 mr1614 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 7.02E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 7.65E-07 2.60E-08 mr1621 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.87E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 1.05E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 6.52E-06 NA mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.50E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 6.26E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.76E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 2.54E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 8.93E-06 2.09E-08 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 6.00E-06 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162333 NA 9.05E-06 mr1504_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251