\
| Variant ID: vg1218161219 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18161219 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )
CATCCCTCTTATTGCCGATGACAATATTTTTAAGCTTTATATCTAATTCTTCCTCGACTTTTCGTTGTGTTGCAGCTCTTCGCACGGATATCGTGACGCA[G/A]
CGGGTCAAGGATGTACTTATCAGTCCTGCTTCCATAGCCGAGGAGGTGCCGACCCCGCTCTGCGACAAGCCAGCGGCCGCCATCAATGTGCGTGAGAAAA
TTTTCTCACGCACATTGATGGCGGCCGCTGGCTTGTCGCAGAGCGGGGTCGGCACCTCCTCGGCTATGGAAGCAGGACTGATAAGTACATCCTTGACCCG[C/T]
TGCGTCACGATATCCGTGCGAAGAGCTGCAACACAACGAAAAGTCGAGGAAGAATTAGATATAAAGCTTAAAAATATTGTCATCGGCAATAAGAGGGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 9.50% | 3.07% | 22.60% | NA |
| All Indica | 2759 | 63.20% | 0.60% | 1.38% | 34.76% | NA |
| All Japonica | 1512 | 65.70% | 27.50% | 6.48% | 0.33% | NA |
| Aus | 269 | 67.30% | 0.00% | 0.37% | 32.34% | NA |
| Indica I | 595 | 91.80% | 0.30% | 0.67% | 7.23% | NA |
| Indica II | 465 | 54.20% | 0.40% | 1.51% | 43.87% | NA |
| Indica III | 913 | 52.00% | 0.70% | 1.42% | 45.89% | NA |
| Indica Intermediate | 786 | 60.10% | 0.90% | 1.78% | 37.28% | NA |
| Temperate Japonica | 767 | 84.40% | 6.50% | 8.60% | 0.52% | NA |
| Tropical Japonica | 504 | 35.10% | 62.10% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 22.00% | 7.47% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 64.40% | 16.70% | 8.89% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218161219 | G -> DEL | LOC_Os12g30270.1 | N | frameshift_variant | Average:49.235; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg1218161219 | G -> A | LOC_Os12g30270.1 | synonymous_variant ; p.Gln43Gln; LOW | synonymous_codon | Average:49.235; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218161219 | 8.14E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1218161219 | NA | 3.57E-08 | mr1124 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 3.22E-06 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | 4.69E-07 | NA | mr1201 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | 4.64E-06 | NA | mr1201 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 1.68E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | 3.12E-06 | NA | mr1219 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 5.82E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 1.61E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 1.26E-11 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 1.55E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 1.03E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 8.89E-06 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 4.10E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218161219 | NA | 4.14E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |