\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218155053:

Variant ID: vg1218155053 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18155053
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, T: 0.33, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCTCAACAGCACGGACGAAGCCTACTCCTCGGAGAAACCACCATCTGACGCATACTCAAACTCTAGGGTTGGGGAAAAATAGAGCAAGACTGAGTAC[A/T]
ACCCACTGTACTCAGCAAGTCATACCGGAACCGGGGTATGCTGCAGGATATTGCCAAAGGATAGCTAGAGAGGTTCTTTTGCATAAAGCGAGCATTTATA

Reverse complement sequence

TATAAATGCTCGCTTTATGCAAAAGAACCTCTCTAGCTATCCTTTGGCAATATCCTGCAGCATACCCCGGTTCCGGTATGACTTGCTGAGTACAGTGGGT[T/A]
GTACTCAGTCTTGCTCTATTTTTCCCCAACCCTAGAGTTTGAGTATGCGTCAGATGGTGGTTTCTCCGAGGAGTAGGCTTCGTCCGTGCTGTTGAGGATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 33.50% 0.59% 22.94% NA
All Indica  2759 59.00% 4.80% 0.76% 35.45% NA
All Japonica  1512 13.50% 86.10% 0.07% 0.33% NA
Aus  269 57.20% 9.30% 1.86% 31.60% NA
Indica I  595 86.90% 6.10% 0.17% 6.89% NA
Indica II  465 51.40% 3.00% 1.08% 44.52% NA
Indica III  913 49.70% 1.80% 0.88% 47.65% NA
Indica Intermediate  786 53.20% 8.40% 0.89% 37.53% NA
Temperate Japonica  767 1.00% 98.30% 0.13% 0.52% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 29.90% 69.70% 0.00% 0.41% NA
VI/Aromatic  96 22.90% 68.80% 0.00% 8.33% NA
Intermediate  90 27.80% 62.20% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218155053 A -> DEL N N silent_mutation Average:25.878; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1218155053 A -> T LOC_Os12g30250.1 upstream_gene_variant ; 2363.0bp to feature; MODIFIER silent_mutation Average:25.878; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1218155053 A -> T LOC_Os12g30260.1 intron_variant ; MODIFIER silent_mutation Average:25.878; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218155053 9.63E-06 NA mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 1.08E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 1.39E-06 1.39E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 6.09E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 7.92E-06 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 6.51E-06 NA mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 1.84E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 7.08E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 5.29E-06 5.29E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 4.00E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 1.34E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 9.56E-06 1.62E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 1.30E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 3.23E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 2.41E-06 2.41E-06 mr1881 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 2.71E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 NA 2.98E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218155053 7.78E-07 7.78E-07 mr1948 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251