\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218154986:

Variant ID: vg1218154986 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18154986
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAAAAACAAAAGATAACTGGAGCTAAGCCTTGACTTGAACGGCAGCGGGAACACCACTCCACAGGCATCCTCAACAGCACGGACGAAGCCTACTCCTC[G/A]
GAGAAACCACCATCTGACGCATACTCAAACTCTAGGGTTGGGGAAAAATAGAGCAAGACTGAGTACAACCCACTGTACTCAGCAAGTCATACCGGAACCG

Reverse complement sequence

CGGTTCCGGTATGACTTGCTGAGTACAGTGGGTTGTACTCAGTCTTGCTCTATTTTTCCCCAACCCTAGAGTTTGAGTATGCGTCAGATGGTGGTTTCTC[C/T]
GAGGAGTAGGCTTCGTCCGTGCTGTTGAGGATGCCTGTGGAGTGGTGTTCCCGCTGCCGTTCAAGTCAAGGCTTAGCTCCAGTTATCTTTTGTTTTTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 36.40% 1.31% 22.13% NA
All Indica  2759 10.10% 53.80% 2.03% 34.07% NA
All Japonica  1512 90.90% 8.70% 0.07% 0.33% NA
Aus  269 37.20% 29.70% 1.49% 31.60% NA
Indica I  595 6.70% 85.90% 1.18% 6.22% NA
Indica II  465 21.70% 33.50% 2.15% 42.58% NA
Indica III  913 3.90% 47.60% 2.96% 45.45% NA
Indica Intermediate  786 13.00% 48.60% 1.53% 36.90% NA
Temperate Japonica  767 98.40% 0.90% 0.13% 0.52% NA
Tropical Japonica  504 79.80% 20.20% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.10% 0.00% 0.41% NA
VI/Aromatic  96 83.30% 8.30% 0.00% 8.33% NA
Intermediate  90 73.30% 16.70% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218154986 G -> DEL N N silent_mutation Average:23.366; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg1218154986 G -> A LOC_Os12g30250.1 upstream_gene_variant ; 2296.0bp to feature; MODIFIER silent_mutation Average:23.366; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg1218154986 G -> A LOC_Os12g30260.1 intron_variant ; MODIFIER silent_mutation Average:23.366; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218154986 NA 2.80E-07 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 8.88E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 5.18E-10 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 4.26E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 2.41E-06 1.70E-07 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 1.46E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 2.29E-07 6.14E-11 mr1352 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 6.24E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 3.69E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 4.62E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 5.74E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 8.83E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 8.98E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 1.53E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 8.36E-06 mr1522 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 7.33E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 7.55E-06 1.07E-07 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 8.48E-06 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 1.31E-06 NA mr1621 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 2.48E-06 7.85E-08 mr1621 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 1.93E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 7.44E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 5.78E-07 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 1.83E-11 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 1.55E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 4.76E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 1.65E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 2.92E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 4.12E-06 2.75E-07 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 7.14E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 NA 4.22E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 7.57E-06 NA mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 4.52E-06 4.72E-08 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154986 8.22E-06 8.22E-06 mr1966 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251