| Variant ID: vg1218154986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18154986 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 82. )
TGGAAAAACAAAAGATAACTGGAGCTAAGCCTTGACTTGAACGGCAGCGGGAACACCACTCCACAGGCATCCTCAACAGCACGGACGAAGCCTACTCCTC[G/A]
GAGAAACCACCATCTGACGCATACTCAAACTCTAGGGTTGGGGAAAAATAGAGCAAGACTGAGTACAACCCACTGTACTCAGCAAGTCATACCGGAACCG
CGGTTCCGGTATGACTTGCTGAGTACAGTGGGTTGTACTCAGTCTTGCTCTATTTTTCCCCAACCCTAGAGTTTGAGTATGCGTCAGATGGTGGTTTCTC[C/T]
GAGGAGTAGGCTTCGTCCGTGCTGTTGAGGATGCCTGTGGAGTGGTGTTCCCGCTGCCGTTCAAGTCAAGGCTTAGCTCCAGTTATCTTTTGTTTTTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.20% | 36.40% | 1.31% | 22.13% | NA |
| All Indica | 2759 | 10.10% | 53.80% | 2.03% | 34.07% | NA |
| All Japonica | 1512 | 90.90% | 8.70% | 0.07% | 0.33% | NA |
| Aus | 269 | 37.20% | 29.70% | 1.49% | 31.60% | NA |
| Indica I | 595 | 6.70% | 85.90% | 1.18% | 6.22% | NA |
| Indica II | 465 | 21.70% | 33.50% | 2.15% | 42.58% | NA |
| Indica III | 913 | 3.90% | 47.60% | 2.96% | 45.45% | NA |
| Indica Intermediate | 786 | 13.00% | 48.60% | 1.53% | 36.90% | NA |
| Temperate Japonica | 767 | 98.40% | 0.90% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 83.30% | 8.30% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 73.30% | 16.70% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218154986 | G -> DEL | N | N | silent_mutation | Average:23.366; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg1218154986 | G -> A | LOC_Os12g30250.1 | upstream_gene_variant ; 2296.0bp to feature; MODIFIER | silent_mutation | Average:23.366; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg1218154986 | G -> A | LOC_Os12g30260.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.366; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218154986 | NA | 2.80E-07 | mr1030 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 8.88E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 5.18E-10 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 4.26E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | 2.41E-06 | 1.70E-07 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 1.46E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | 2.29E-07 | 6.14E-11 | mr1352 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 6.24E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 3.69E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218154986 | NA | 4.62E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/