\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218154919:

Variant ID: vg1218154919 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18154919
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAACGACAAAGTTGACATACAGATCCACGTCTTACAAACATTATAAAAGTCTTACATAAGTGCAGTGGAAAAACAAAAGATAACTGGAGCTAAGCCTT[G/A]
ACTTGAACGGCAGCGGGAACACCACTCCACAGGCATCCTCAACAGCACGGACGAAGCCTACTCCTCGGAGAAACCACCATCTGACGCATACTCAAACTCT

Reverse complement sequence

AGAGTTTGAGTATGCGTCAGATGGTGGTTTCTCCGAGGAGTAGGCTTCGTCCGTGCTGTTGAGGATGCCTGTGGAGTGGTGTTCCCGCTGCCGTTCAAGT[C/T]
AAGGCTTAGCTCCAGTTATCTTTTGTTTTTCCACTGCACTTATGTAAGACTTTTATAATGTTTGTAAGACGTGGATCTGTATGTCAACTTTGTCGTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 36.80% 0.72% 22.85% NA
All Indica  2759 9.40% 54.40% 0.98% 35.27% NA
All Japonica  1512 90.70% 8.80% 0.13% 0.33% NA
Aus  269 35.70% 30.90% 1.12% 32.34% NA
Indica I  595 6.60% 86.60% 0.17% 6.72% NA
Indica II  465 21.70% 33.30% 1.29% 43.66% NA
Indica III  913 3.10% 48.10% 1.10% 47.75% NA
Indica Intermediate  786 11.60% 49.70% 1.27% 37.40% NA
Temperate Japonica  767 98.30% 1.00% 0.13% 0.52% NA
Tropical Japonica  504 79.40% 20.40% 0.20% 0.00% NA
Japonica Intermediate  241 90.50% 9.10% 0.00% 0.41% NA
VI/Aromatic  96 83.30% 8.30% 0.00% 8.33% NA
Intermediate  90 73.30% 16.70% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218154919 G -> DEL N N silent_mutation Average:22.929; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg1218154919 G -> A LOC_Os12g30250.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:22.929; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg1218154919 G -> A LOC_Os12g30260.1 intron_variant ; MODIFIER silent_mutation Average:22.929; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218154919 NA 6.35E-06 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 1.16E-11 mr1170 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 3.48E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 2.52E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 9.29E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 1.32E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 3.20E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 2.71E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 3.26E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 5.14E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 3.95E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 1.33E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 4.39E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 7.49E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154919 NA 5.46E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251