\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218154337:

Variant ID: vg1218154337 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18154337
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.11, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGACAAAGGGGTAGGATCAATGCATGCTCAAATCCAATTTTAATGAAGCAGTAAAAGACTCAAATTAAATAGGCGAATAAAAGCGGAATTTTATACAC[A/T]
GATCATTTGTTTTGCATGAAGGCGAATAAATAAGACGGACTTACATAGCGATAAAATGATGAGAAAATTAGGTACATATTAATAATAATAATAATAATAA

Reverse complement sequence

TTATTATTATTATTATTATTAATATGTACCTAATTTTCTCATCATTTTATCGCTATGTAAGTCCGTCTTATTTATTCGCCTTCATGCAAAACAAATGATC[T/A]
GTGTATAAAATTCCGCTTTTATTCGCCTATTTAATTTGAGTCTTTTACTGCTTCATTAAAATTGGATTTGAGCATGCATTGATCCTACCCCTTTGTCTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 36.90% 0.87% 23.00% NA
All Indica  2759 9.10% 54.40% 1.38% 35.12% NA
All Japonica  1512 90.20% 8.90% 0.13% 0.73% NA
Aus  269 34.90% 31.20% 0.37% 33.46% NA
Indica I  595 6.20% 86.60% 0.34% 6.89% NA
Indica II  465 21.70% 33.30% 1.94% 43.01% NA
Indica III  913 2.80% 48.20% 1.10% 47.86% NA
Indica Intermediate  786 10.90% 49.90% 2.16% 37.02% NA
Temperate Japonica  767 98.00% 1.00% 0.13% 0.78% NA
Tropical Japonica  504 78.60% 20.60% 0.20% 0.60% NA
Japonica Intermediate  241 89.60% 9.50% 0.00% 0.83% NA
VI/Aromatic  96 83.30% 8.30% 0.00% 8.33% NA
Intermediate  90 72.20% 17.80% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218154337 A -> DEL N N silent_mutation Average:29.685; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1218154337 A -> T LOC_Os12g30250.1 upstream_gene_variant ; 1647.0bp to feature; MODIFIER silent_mutation Average:29.685; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1218154337 A -> T LOC_Os12g30260.1 intron_variant ; MODIFIER silent_mutation Average:29.685; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218154337 NA 1.31E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 2.65E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 6.13E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 6.82E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 2.51E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 3.70E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 2.81E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 5.45E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 5.15E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 5.87E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 6.14E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 7.67E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 6.76E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 1.67E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 2.22E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 2.92E-06 2.26E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 5.00E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 7.82E-10 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 1.46E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 7.48E-06 mr1761 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 8.19E-10 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 1.57E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 9.23E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218154337 NA 2.41E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251