Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218153803:

Variant ID: vg1218153803 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18153803
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TCAACTGAGCATTCTCCTTCTTCAAGCGTGCTATCTTATCCTTCAGAGCTATGATCCTCACGAGCTTCCCGTCATTCAAGGCCTTGGACGCCTAACGCAT[A/G]
TCTGAGTGCATCCTGTCCATTCCCCTCATTACGGCACACATGTGACCAAAGGTGGTGTCGTTCTCACCGGCTATCGGACGGAAGGTGTTGACGTCATCGC

Reverse complement sequence

GCGATGACGTCAACACCTTCCGTCCGATAGCCGGTGAGAACGACACCACCTTTGGTCACATGTGTGCCGTAATGAGGGGAATGGACAGGATGCACTCAGA[T/C]
ATGCGTTAGGCGTCCAAGGCCTTGAATGACGGGAAGCTCGTGAGGATCATAGCTCTGAAGGATAAGATAGCACGCTTGAAGAAGGAGAATGCTCAGTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	37.10%	0.99%	21.84%	NA
All Indica	2759	10.00%	54.80%	1.63%	33.56%	NA
All Japonica	1512	90.80%	8.90%	0.00%	0.33%	NA
Aus	269	36.10%	31.20%	0.74%	31.97%	NA
Indica I	595	6.10%	86.90%	0.34%	6.72%	NA
Indica II	465	22.40%	33.80%	2.80%	41.08%	NA
Indica III	913	4.20%	48.40%	1.53%	45.89%	NA
Indica Intermediate	786	12.60%	50.30%	2.04%	35.11%	NA
Temperate Japonica	767	98.40%	1.00%	0.00%	0.52%	NA
Tropical Japonica	504	79.40%	20.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	9.10%	0.00%	0.41%	NA
VI/Aromatic	96	83.30%	9.40%	0.00%	7.29%	NA
Intermediate	90	74.40%	16.70%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218153803	A -> DEL	N	N	silent_mutation	Average:56.253; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1218153803	A -> G	LOC_Os12g30240.1	upstream_gene_variant ; 4711.0bp to feature; MODIFIER	silent_mutation	Average:56.253; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1218153803	A -> G	LOC_Os12g30250.1	upstream_gene_variant ; 1113.0bp to feature; MODIFIER	silent_mutation	Average:56.253; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1218153803	A -> G	LOC_Os12g30260.1	intron_variant ; MODIFIER	silent_mutation	Average:56.253; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218153803	NA	9.17E-07	mr1030	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	5.36E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	2.89E-09	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	8.51E-06	NA	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	8.06E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	4.91E-07	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	5.06E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	5.88E-06	NA	mr1271	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	9.75E-11	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	7.36E-08	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	4.41E-06	4.38E-07	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	7.89E-06	NA	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	4.16E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	9.05E-06	6.20E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	8.43E-07	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	2.69E-06	NA	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.61E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	4.20E-06	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.00E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.87E-07	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	8.02E-07	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.01E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	8.14E-06	2.16E-06	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.72E-08	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	8.42E-07	mr1549	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	9.29E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.92E-06	mr1621	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	5.00E-07	3.09E-11	mr1623	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.90E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	2.46E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	3.30E-11	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	6.36E-06	9.82E-08	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	2.78E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	2.44E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.44E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	7.94E-10	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	2.21E-06	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	8.87E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	4.23E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	4.62E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	3.89E-06	NA	mr1965	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	8.47E-07	8.89E-09	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153803	NA	1.86E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251