\
| Variant ID: vg1218152575 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18152575 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, C: 0.12, others allele: 0.00, population size: 92. )
CACAACCCCGTCTGGCACCTGCGCCTTCCTGAAGCTACGACAGAACTCCGCCCAAGTGACTTCTGTGCCTGGCGGGTGGGTAGCCATGTGATTGTCCCAC[A/C]
AAGCTGACGCGGGACCCTGGAGCTGGTGTGTGGCAAAGGCGACCTTGTCCTGATCATTGCACTGCATAAGGTTTAGCTTCTTCTCTATGGCATGGAGCCA
TGGCTCCATGCCATAGAGAAGAAGCTAAACCTTATGCAGTGCAATGATCAGGACAAGGTCGCCTTTGCCACACACCAGCTCCAGGGTCCCGCGTCAGCTT[T/G]
GTGGGACAATCACATGGCTACCCACCCGCCAGGCACAGAAGTCACTTGGGCGGAGTTCTGTCGTAGCTTCAGGAAGGCGCAGGTGCCAGACGGGGTTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 36.40% | 1.71% | 0.63% | NA |
| All Indica | 2759 | 93.70% | 5.10% | 1.01% | 0.14% | NA |
| All Japonica | 1512 | 9.10% | 89.20% | 0.73% | 0.93% | NA |
| Aus | 269 | 49.10% | 35.30% | 13.38% | 2.23% | NA |
| Indica I | 595 | 93.40% | 6.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 96.30% | 2.50% | 0.99% | 0.22% | NA |
| Indica Intermediate | 786 | 89.60% | 8.50% | 1.65% | 0.25% | NA |
| Temperate Japonica | 767 | 1.30% | 98.20% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 20.60% | 75.60% | 1.59% | 2.18% | NA |
| Japonica Intermediate | 241 | 10.00% | 89.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 13.50% | 81.20% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 27.80% | 64.40% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218152575 | A -> C | LOC_Os12g30250.1 | missense_variant ; p.Leu39Trp; MODERATE | nonsynonymous_codon ; L39W | Average:30.631; most accessible tissue: Callus, score: 44.227 | possibly damaging |
-1.781 |
TOLERATED | 1.00 |
| vg1218152575 | A -> DEL | LOC_Os12g30250.1 | N | frameshift_variant | Average:30.631; most accessible tissue: Callus, score: 44.227 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218152575 | 7.69E-06 | NA | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | 1.56E-07 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | 3.03E-07 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | 4.50E-06 | NA | mr1023 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | NA | 2.18E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | 5.85E-06 | NA | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | 3.23E-07 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | NA | 8.58E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | NA | 7.69E-17 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | NA | 7.69E-17 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | 9.25E-06 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | NA | 3.27E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218152575 | NA | 6.36E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |