Search for Variation information by Variation ID:
Detailed information for vg1218127939:
| Variant ID: vg1218127939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18127939 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 90. )
Flanking Sequence (100 bp) in Reference Genome:
GCCCACCAAAATTTTTCTTTGAGATCTTGATACATCTTGGTACTACCCGGATGAATGGAATATTGAGTCTGATGAGCCTCAGTAAGTATCAGATCGTTCA[G/T]
CTCTTTATCATCGGGCACGCACAATCTTTCTCCCATCCAGATCATGCCATGTTCATCCTCAAGGATGTCCCGGGCTTTTCTGACCCTCATATTCTTTTTT
Reverse complement sequence
AAAAAAGAATATGAGGGTCAGAAAAGCCCGGGACATCCTTGAGGATGAACATGGCATGATCTGGATGGGAGAAAGATTGTGCGTGCCCGATGATAAAGAG[C/A]
TGAACGATCTGATACTTACTGAGGCTCATCAGACTCAATATTCCATTCATCCGGGTAGTACCAAGATGTATCAAGATCTCAAAGAAAAATTTTGGTGGGC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.60% | 37.00% | 0.51% | 22.89% | NA |
| All Indica | 2759 | 9.40% | 54.60% | 0.69% | 35.38% | NA |
| All Japonica | 1512 | 90.90% | 8.80% | 0.00% | 0.33% | NA |
| Aus | 269 | 35.70% | 31.60% | 1.49% | 31.23% | NA |
| Indica I | 595 | 5.70% | 87.20% | 0.17% | 6.89% | NA |
| Indica II | 465 | 21.50% | 33.50% | 0.43% | 44.52% | NA |
| Indica III | 913 | 3.40% | 48.20% | 1.31% | 47.10% | NA |
| Indica Intermediate | 786 | 11.80% | 49.70% | 0.51% | 37.91% | NA |
| Temperate Japonica | 767 | 98.60% | 0.90% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 83.30% | 8.30% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 71.10% | 17.80% | 1.11% | 10.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218127939 | G -> DEL | LOC_Os12g30200.1 | N | frameshift_variant | Average:38.613; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg1218127939 | G -> T | LOC_Os12g30200.1 | missense_variant ; p.Leu761Met; MODERATE | nonsynonymous_codon ; L761M | Average:38.613; most accessible tissue: Minghui63 flag leaf, score: 52.88 | probably damaging  |
2.441 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218127939 | NA | 2.91E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | NA | 4.36E-06 | mr1407 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | 1.24E-06 | NA | mr1528 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | NA | 3.03E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | NA | 2.60E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | NA | 8.20E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | NA | 5.04E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127939 | NA | 3.74E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |