\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218127830:

Variant ID: vg1218127830 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18127830
Reference Allele: TTCAlternative Allele: CTC,T
Primary Allele: CTCSecondary Allele: TTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGATTTGAAGAGGTTGTAGCAATCCTGCGGGCCTCTGATGTTCTGCTTTAACTCGCTGACAAACATCGCAGAGCGCGACGAATTCAGCTATCTCCCTT[TTC/CTC,T]
ATGCTGGCCCACCAAAATTTTTCTTTGAGATCTTGATACATCTTGGTACTACCCGGATGAATGGAATATTGAGTCTGATGAGCCTCAGTAAGTATCAGAT

Reverse complement sequence

ATCTGATACTTACTGAGGCTCATCAGACTCAATATTCCATTCATCCGGGTAGTACCAAGATGTATCAAGATCTCAAAGAAAAATTTTGGTGGGCCAGCAT[GAA/GAG,A]
AAGGGAGATAGCTGAATTCGTCGCGCTCTGCGATGTTTGTCAGCGAGTTAAAGCAGAACATCAGAGGCCCGCAGGATTGCTACAACCTCTTCAAATCCCG

Allele Frequencies:

Populations Population SizeFrequency of CTC(primary allele) Frequency of TTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 32.60% 6.39% 15.70% T: 3.05%
All Indica  2759 63.80% 4.50% 8.66% 22.33% T: 0.76%
All Japonica  1512 8.80% 84.50% 0.26% 1.72% T: 4.76%
Aus  269 30.10% 7.80% 19.70% 31.60% T: 10.78%
Indica I  595 88.40% 5.00% 1.18% 5.38% NA
Indica II  465 41.50% 4.70% 25.81% 27.96% NA
Indica III  913 65.20% 1.10% 5.59% 26.62% T: 1.53%
Indica Intermediate  786 56.70% 7.80% 7.76% 26.84% T: 0.89%
Temperate Japonica  767 0.90% 98.20% 0.13% 0.52% T: 0.26%
Tropical Japonica  504 20.60% 71.00% 0.40% 3.97% T: 3.97%
Japonica Intermediate  241 9.10% 68.90% 0.41% 0.83% T: 20.75%
VI/Aromatic  96 6.20% 68.80% 3.12% 7.29% T: 14.58%
Intermediate  90 18.90% 60.00% 3.33% 8.89% T: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218127830 TTC -> CTC LOC_Os12g30200.1 missense_variant ; p.Lys797Arg; MODERATE nonsynonymous_codon ; K797R Average:33.26; most accessible tissue: Zhenshan97 panicle, score: 43.098 benign +0.611 N N
vg1218127830 TTC -> DEL LOC_Os12g30200.1 N frameshift_variant Average:33.26; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1218127830 TTC -> T LOC_Os12g30200.1 frameshift_variant ; p.Met796fs; HIGH frameshift_variant Average:33.26; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218127830 NA 1.56E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 1.51E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 3.05E-18 mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 8.91E-12 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 1.41E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 4.84E-06 4.84E-06 mr1349 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 5.41E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 1.62E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 5.18E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 5.41E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 5.10E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 4.39E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 3.28E-06 NA mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 3.50E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 1.35E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 3.68E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 2.22E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 2.40E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127830 NA 5.30E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251