\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218127805:

Variant ID: vg1218127805 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18127805
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCAATTTCTTCCCATTTCCATTCCGGGATTTGAAGAGGTTGTAGCAATCCTGCGGGCCTCTGATGTTCTGCTTTAACTCGCTGACAAACATCGCAGAG[C/T]
GCGACGAATTCAGCTATCTCCCTTTTCATGCTGGCCCACCAAAATTTTTCTTTGAGATCTTGATACATCTTGGTACTACCCGGATGAATGGAATATTGAG

Reverse complement sequence

CTCAATATTCCATTCATCCGGGTAGTACCAAGATGTATCAAGATCTCAAAGAAAAATTTTGGTGGGCCAGCATGAAAAGGGAGATAGCTGAATTCGTCGC[G/A]
CTCTGCGATGTTTGTCAGCGAGTTAAAGCAGAACATCAGAGGCCCGCAGGATTGCTACAACCTCTTCAAATCCCGGAATGGAAATGGGAAGAAATTGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 15.90% 3.85% 12.36% NA
All Indica  2759 74.40% 2.30% 5.40% 17.87% NA
All Japonica  1512 57.70% 40.70% 0.40% 1.19% NA
Aus  269 68.40% 0.40% 9.29% 21.93% NA
Indica I  595 92.40% 1.70% 0.67% 5.21% NA
Indica II  465 69.20% 0.60% 7.96% 22.15% NA
Indica III  913 70.60% 2.30% 7.45% 19.61% NA
Indica Intermediate  786 68.20% 3.80% 5.09% 22.90% NA
Temperate Japonica  767 77.30% 22.30% 0.00% 0.39% NA
Tropical Japonica  504 26.80% 69.40% 1.19% 2.58% NA
Japonica Intermediate  241 60.20% 39.00% 0.00% 0.83% NA
VI/Aromatic  96 50.00% 42.70% 1.04% 6.25% NA
Intermediate  90 55.60% 34.40% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218127805 C -> DEL LOC_Os12g30200.1 N frameshift_variant Average:33.3; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1218127805 C -> T LOC_Os12g30200.1 synonymous_variant ; p.Ala805Ala; LOW synonymous_codon Average:33.3; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218127805 NA 2.89E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 7.11E-07 1.34E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 5.17E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 4.22E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 2.16E-07 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 8.14E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 4.29E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 4.60E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 6.93E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 6.93E-09 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 7.65E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 9.00E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 3.23E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 5.58E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 4.79E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 4.96E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 2.60E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 7.64E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 6.31E-06 NA mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 4.17E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 1.95E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 5.12E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 3.20E-06 4.68E-06 mr1685 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 2.18E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 2.18E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 1.85E-06 2.55E-11 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 1.97E-07 mr1786 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 5.28E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 3.40E-06 mr1977 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 3.82E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 8.44E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 7.23E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 9.39E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218127805 NA 9.94E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251