\
| Variant ID: vg1218127576 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18127576 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, C: 0.36, others allele: 0.00, population size: 88. )
TGCAATTTCTGCCAGAACTTTGAAGTGAATTGGCTCCCTCGATCAGATACTATCTTTTTGGGTACTCCATGTAGACACATGATCCTCGAGAGATGGAGCT[A/C]
TGCCAACCTTTTGCCCGTATAAGTAGTATGCACTGGAATGAAATGAGCAACTTTGGTAAGTCGGTCCACGACTACCCAGATTGAATCGTGACCAGATGAT
ATCATCTGGTCACGATTCAATCTGGGTAGTCGTGGACCGACTTACCAAAGTTGCTCATTTCATTCCAGTGCATACTACTTATACGGGCAAAAGGTTGGCA[T/G]
AGCTCCATCTCTCGAGGATCATGTGTCTACATGGAGTACCCAAAAAGATAGTATCTGATCGAGGGAGCCAATTCACTTCAAAGTTCTGGCAGAAATTGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 36.70% | 4.57% | 19.04% | NA |
| All Indica | 2759 | 9.40% | 54.20% | 7.72% | 28.63% | NA |
| All Japonica | 1512 | 90.80% | 8.80% | 0.07% | 0.33% | NA |
| Aus | 269 | 35.70% | 30.90% | 0.74% | 32.71% | NA |
| Indica I | 595 | 5.50% | 87.10% | 1.01% | 6.39% | NA |
| Indica II | 465 | 22.20% | 33.10% | 5.38% | 39.35% | NA |
| Indica III | 913 | 3.40% | 48.10% | 15.22% | 33.30% | NA |
| Indica Intermediate | 786 | 11.80% | 49.00% | 5.47% | 33.72% | NA |
| Temperate Japonica | 767 | 98.40% | 0.90% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 83.30% | 8.30% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 73.30% | 16.70% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218127576 | A -> C | LOC_Os12g30200.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:32.163; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1218127576 | A -> DEL | N | N | silent_mutation | Average:32.163; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218127576 | NA | 6.57E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 2.19E-06 | NA | mr1127 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 7.49E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 3.92E-07 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 4.09E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 2.52E-06 | NA | mr1265 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 4.64E-06 | 7.30E-06 | mr1271 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 1.26E-06 | 4.83E-06 | mr1295 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 1.13E-15 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 1.13E-15 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 5.73E-07 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 9.02E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 1.40E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 1.26E-06 | NA | mr1528 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 4.59E-06 | 4.59E-06 | mr1576 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 6.30E-07 | NA | mr1592 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 5.86E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 6.96E-06 | mr1669 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 5.94E-07 | mr1708 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 8.43E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 1.12E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 4.20E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | 9.10E-06 | 7.64E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 9.75E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 9.75E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 8.76E-09 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127576 | NA | 8.48E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |