\
| Variant ID: vg1218127273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18127273 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 82. )
CCGTTAACACTTCTGTTCCGAACAGTTGACGTTCGCCCGTTTGATCCCAGAAGAGAGGCCGTACAATGCTTCTGTTAACACTTCCAACCGTACAACGCTT[T/C]
GAACGGCGCCATATGTAGACTGGCCTGATAGCTGTTGTTGTAAGAGAACTCCACATATGGCAAGATTTTGTCCCAGGCTCCACCAAAATCAAGTGCACAA
TTGTGCACTTGATTTTGGTGGAGCCTGGGACAAAATCTTGCCATATGTGGAGTTCTCTTACAACAACAGCTATCAGGCCAGTCTACATATGGCGCCGTTC[A/G]
AAGCGTTGTACGGTTGGAAGTGTTAACAGAAGCATTGTACGGCCTCTCTTCTGGGATCAAACGGGCGAACGTCAACTGTTCGGAACAGAAGTGTTAACGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 1.20% | 6.24% | 52.81% | NA |
| All Indica | 2759 | 9.40% | 1.80% | 7.50% | 81.26% | NA |
| All Japonica | 1512 | 90.90% | 0.10% | 1.12% | 7.87% | NA |
| Aus | 269 | 36.10% | 1.90% | 24.91% | 37.17% | NA |
| Indica I | 595 | 5.90% | 3.70% | 6.05% | 84.37% | NA |
| Indica II | 465 | 21.70% | 1.10% | 4.73% | 72.47% | NA |
| Indica III | 913 | 3.40% | 0.70% | 9.64% | 86.31% | NA |
| Indica Intermediate | 786 | 11.80% | 2.20% | 7.76% | 78.24% | NA |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.52% | 0.91% | NA |
| Tropical Japonica | 504 | 79.40% | 0.40% | 0.40% | 19.84% | NA |
| Japonica Intermediate | 241 | 90.50% | 0.00% | 4.56% | 4.98% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 3.12% | 13.54% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 1.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218127273 | T -> C | LOC_Os12g30200.1 | synonymous_variant ; p.Ser895Ser; LOW | synonymous_codon | Average:26.567; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1218127273 | T -> DEL | LOC_Os12g30200.1 | N | frameshift_variant | Average:26.567; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218127273 | 8.91E-06 | NA | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | 7.01E-06 | 7.01E-06 | mr1046 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 4.01E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 1.15E-10 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | 6.27E-06 | NA | mr1127 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.65E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 1.69E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 5.17E-06 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 6.34E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 6.03E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | 2.44E-06 | NA | mr1265 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 1.00E-08 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 5.27E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.94E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 6.50E-16 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.08E-06 | mr1407 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 4.50E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 6.50E-16 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 7.26E-07 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 1.61E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 5.62E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | 1.56E-06 | NA | mr1528 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.38E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 4.61E-06 | mr1669 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | 6.68E-06 | 1.16E-07 | mr1708 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 8.57E-08 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 1.18E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 6.40E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.16E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.16E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 1.58E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 3.41E-08 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 8.72E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 5.84E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 6.14E-21 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 9.64E-06 | mr1965 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 5.54E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218127273 | NA | 9.45E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |