Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218126488:

Variant ID: vg1218126488 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18126488
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTTTAATTGGTTAAAATTATTTCTAGAGCTCTGAAAATTCCACTAAAAATCTTGTTAGCATATTTCAACGTGTAGAACTCAAGAAAAATCCCACATG[A/C,T]
CAATTCCGATTATTATTTGCATTAATTTATTAGGGTTTCTCTTGCTTTGACACCGATATTTTCTCATGGTGATTTATAAATTCAATTTAGGCTTGGGGAG

Reverse complement sequence

CTCCCCAAGCCTAAATTGAATTTATAAATCACCATGAGAAAATATCGGTGTCAAAGCAAGAGAAACCCTAATAAATTAATGCAAATAATAATCGGAATTG[T/G,A]
CATGTGGGATTTTTCTTGAGTTCTACACGTTGAAATATGCTAACAAGATTTTTAGTGGAATTTTCAGAGCTCTAGAAATAATTTTAACCAATTAAAATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.90%	32.80%	0.17%	23.61%	T: 0.49%
All Indica	2759	58.40%	4.20%	0.14%	36.46%	T: 0.80%
All Japonica	1512	13.70%	85.80%	0.07%	0.33%	T: 0.07%
Aus	269	58.70%	7.80%	0.00%	33.46%	NA
Indica I	595	87.70%	5.00%	0.17%	7.06%	NA
Indica II	465	50.50%	3.00%	0.22%	45.38%	T: 0.86%
Indica III	913	49.20%	1.10%	0.11%	49.07%	T: 0.55%
Indica Intermediate	786	51.70%	7.80%	0.13%	38.80%	T: 1.65%
Temperate Japonica	767	1.30%	97.90%	0.13%	0.52%	T: 0.13%
Tropical Japonica	504	24.60%	75.40%	0.00%	0.00%	NA
Japonica Intermediate	241	30.30%	69.30%	0.00%	0.41%	NA
VI/Aromatic	96	24.00%	67.70%	2.08%	6.25%	NA
Intermediate	90	30.00%	58.90%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218126488	A -> C	LOC_Os12g30190.1	upstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N
vg1218126488	A -> C	LOC_Os12g30200.1	downstream_gene_variant ; 131.0bp to feature; MODIFIER	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N
vg1218126488	A -> C	LOC_Os12g30190-LOC_Os12g30200	intergenic_region ; MODIFIER	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N
vg1218126488	A -> DEL	N	N	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N
vg1218126488	A -> T	LOC_Os12g30190.1	upstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N
vg1218126488	A -> T	LOC_Os12g30200.1	downstream_gene_variant ; 131.0bp to feature; MODIFIER	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N
vg1218126488	A -> T	LOC_Os12g30190-LOC_Os12g30200	intergenic_region ; MODIFIER	silent_mutation	Average:24.502; most accessible tissue: Callus, score: 40.085	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218126488	7.70E-06	NA	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	3.52E-06	NA	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.67E-22	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	4.49E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.78E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.53E-17	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	5.66E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	6.79E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.28E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.81E-16	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	6.80E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	3.00E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	6.62E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	2.39E-06	NA	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.81E-16	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	8.59E-07	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	8.60E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	3.32E-09	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	7.14E-06	6.39E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	4.40E-06	NA	mr1528	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	7.34E-06	7.34E-06	mr1528	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	4.40E-06	4.40E-06	mr1564	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.66E-37	mr1601	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	7.10E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	4.88E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	2.12E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.28E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	7.57E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	5.83E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	2.90E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	2.90E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	2.93E-06	NA	mr1809	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	2.22E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	7.31E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	1.21E-06	NA	mr1820	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	2.33E-20	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	1.02E-08	NA	mr1876	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	4.35E-08	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	4.67E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.91E-14	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	6.19E-23	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	9.39E-06	mr1944	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488	NA	1.49E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251