\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218126488:

Variant ID: vg1218126488 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18126488
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTTTAATTGGTTAAAATTATTTCTAGAGCTCTGAAAATTCCACTAAAAATCTTGTTAGCATATTTCAACGTGTAGAACTCAAGAAAAATCCCACATG[A/C,T]
CAATTCCGATTATTATTTGCATTAATTTATTAGGGTTTCTCTTGCTTTGACACCGATATTTTCTCATGGTGATTTATAAATTCAATTTAGGCTTGGGGAG

Reverse complement sequence

CTCCCCAAGCCTAAATTGAATTTATAAATCACCATGAGAAAATATCGGTGTCAAAGCAAGAGAAACCCTAATAAATTAATGCAAATAATAATCGGAATTG[T/G,A]
CATGTGGGATTTTTCTTGAGTTCTACACGTTGAAATATGCTAACAAGATTTTTAGTGGAATTTTCAGAGCTCTAGAAATAATTTTAACCAATTAAAATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.90% 32.80% 0.17% 23.61% T: 0.49%
All Indica  2759 58.40% 4.20% 0.14% 36.46% T: 0.80%
All Japonica  1512 13.70% 85.80% 0.07% 0.33% T: 0.07%
Aus  269 58.70% 7.80% 0.00% 33.46% NA
Indica I  595 87.70% 5.00% 0.17% 7.06% NA
Indica II  465 50.50% 3.00% 0.22% 45.38% T: 0.86%
Indica III  913 49.20% 1.10% 0.11% 49.07% T: 0.55%
Indica Intermediate  786 51.70% 7.80% 0.13% 38.80% T: 1.65%
Temperate Japonica  767 1.30% 97.90% 0.13% 0.52% T: 0.13%
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 30.30% 69.30% 0.00% 0.41% NA
VI/Aromatic  96 24.00% 67.70% 2.08% 6.25% NA
Intermediate  90 30.00% 58.90% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218126488 A -> C LOC_Os12g30190.1 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N
vg1218126488 A -> C LOC_Os12g30200.1 downstream_gene_variant ; 131.0bp to feature; MODIFIER silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N
vg1218126488 A -> C LOC_Os12g30190-LOC_Os12g30200 intergenic_region ; MODIFIER silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N
vg1218126488 A -> DEL N N silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N
vg1218126488 A -> T LOC_Os12g30190.1 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N
vg1218126488 A -> T LOC_Os12g30200.1 downstream_gene_variant ; 131.0bp to feature; MODIFIER silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N
vg1218126488 A -> T LOC_Os12g30190-LOC_Os12g30200 intergenic_region ; MODIFIER silent_mutation Average:24.502; most accessible tissue: Callus, score: 40.085 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218126488 7.70E-06 NA mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 3.52E-06 NA mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.67E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 4.49E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.78E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.53E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 5.66E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 6.79E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.28E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.81E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 6.80E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 3.00E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 6.62E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 2.39E-06 NA mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.81E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 8.59E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 8.60E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 3.32E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 7.14E-06 6.39E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 4.40E-06 NA mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 7.34E-06 7.34E-06 mr1528 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 4.40E-06 4.40E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.66E-37 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 7.10E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 4.88E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 2.12E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.28E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 7.57E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 5.83E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 2.90E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 2.90E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 2.93E-06 NA mr1809 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 2.22E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 7.31E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 1.21E-06 NA mr1820 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 2.33E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 1.02E-08 NA mr1876 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 4.35E-08 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 4.67E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.91E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 6.19E-23 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 9.39E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218126488 NA 1.49E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251