\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218123524:

Variant ID: vg1218123524 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18123524
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGAGAACAAGCCGCTTGGGCTGTGTTGCTTGGTCGGTGTTTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCATAGTGTGCATTAAAATCCCT[G/A]
TCCAGGACTGGCCGGGGTACACAAACGACAAAGTTGACATACAGATCCACGTCTTACATACATTATAAGAGTCTTATATAAGTGCAGCGGAAAAACAAAA

Reverse complement sequence

TTTTGTTTTTCCGCTGCACTTATATAAGACTCTTATAATGTATGTAAGACGTGGATCTGTATGTCAACTTTGTCGTTTGTGTACCCCGGCCAGTCCTGGA[C/T]
AGGGATTTTAATGCACACTATGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAAACACCGACCAAGCAACACAGCCCAAGCGGCTTGTTCTCATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 24.00% 0.49% 22.98% NA
All Indica  2759 24.20% 39.40% 0.58% 35.77% NA
All Japonica  1512 98.40% 1.30% 0.00% 0.33% NA
Aus  269 63.60% 5.60% 2.23% 28.62% NA
Indica I  595 6.60% 85.70% 0.50% 7.23% NA
Indica II  465 41.30% 13.30% 0.43% 44.95% NA
Indica III  913 26.10% 25.60% 0.55% 47.75% NA
Indica Intermediate  786 25.40% 35.80% 0.76% 38.04% NA
Temperate Japonica  767 98.60% 0.90% 0.00% 0.52% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.00% 0.41% NA
VI/Aromatic  96 90.60% 1.00% 0.00% 8.33% NA
Intermediate  90 74.40% 14.40% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218123524 G -> DEL N N silent_mutation Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1218123524 G -> A LOC_Os12g30190.1 upstream_gene_variant ; 1530.0bp to feature; MODIFIER silent_mutation Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1218123524 G -> A LOC_Os12g30180.1 downstream_gene_variant ; 2844.0bp to feature; MODIFIER silent_mutation Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1218123524 G -> A LOC_Os12g30200.1 downstream_gene_variant ; 3095.0bp to feature; MODIFIER silent_mutation Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1218123524 G -> A LOC_Os12g30190-LOC_Os12g30200 intergenic_region ; MODIFIER silent_mutation Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218123524 NA 3.41E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 3.29E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 4.04E-07 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 2.68E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 7.38E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 1.49E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 1.57E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 4.10E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 1.73E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 3.81E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 5.44E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 4.60E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 7.43E-14 mr1860 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 6.34E-08 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 5.15E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524 NA 6.85E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251