Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218123524:

Variant ID: vg1218123524 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18123524
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGAGAACAAGCCGCTTGGGCTGTGTTGCTTGGTCGGTGTTTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCATAGTGTGCATTAAAATCCCT[G/A]
TCCAGGACTGGCCGGGGTACACAAACGACAAAGTTGACATACAGATCCACGTCTTACATACATTATAAGAGTCTTATATAAGTGCAGCGGAAAAACAAAA

Reverse complement sequence

TTTTGTTTTTCCGCTGCACTTATATAAGACTCTTATAATGTATGTAAGACGTGGATCTGTATGTCAACTTTGTCGTTTGTGTACCCCGGCCAGTCCTGGA[C/T]
AGGGATTTTAATGCACACTATGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAAACACCGACCAAGCAACACAGCCCAAGCGGCTTGTTCTCATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	24.00%	0.49%	22.98%	NA
All Indica	2759	24.20%	39.40%	0.58%	35.77%	NA
All Japonica	1512	98.40%	1.30%	0.00%	0.33%	NA
Aus	269	63.60%	5.60%	2.23%	28.62%	NA
Indica I	595	6.60%	85.70%	0.50%	7.23%	NA
Indica II	465	41.30%	13.30%	0.43%	44.95%	NA
Indica III	913	26.10%	25.60%	0.55%	47.75%	NA
Indica Intermediate	786	25.40%	35.80%	0.76%	38.04%	NA
Temperate Japonica	767	98.60%	0.90%	0.00%	0.52%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.00%	0.41%	NA
VI/Aromatic	96	90.60%	1.00%	0.00%	8.33%	NA
Intermediate	90	74.40%	14.40%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218123524	G -> DEL	N	N	silent_mutation	Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1218123524	G -> A	LOC_Os12g30190.1	upstream_gene_variant ; 1530.0bp to feature; MODIFIER	silent_mutation	Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1218123524	G -> A	LOC_Os12g30180.1	downstream_gene_variant ; 2844.0bp to feature; MODIFIER	silent_mutation	Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1218123524	G -> A	LOC_Os12g30200.1	downstream_gene_variant ; 3095.0bp to feature; MODIFIER	silent_mutation	Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1218123524	G -> A	LOC_Os12g30190-LOC_Os12g30200	intergenic_region ; MODIFIER	silent_mutation	Average:38.282; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218123524	NA	3.41E-08	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	3.29E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	4.04E-07	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	2.68E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	7.38E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	1.49E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	1.57E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	4.10E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	1.73E-06	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	3.81E-06	mr1755	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	5.44E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	4.60E-06	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	7.43E-14	mr1860	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	6.34E-08	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	5.15E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218123524	NA	6.85E-10	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251