Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218122202:

Variant ID: vg1218122202 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18122202
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGAGATGCGAGACGTGCGCCACCTGCTGCCTCTATCGGCGCCCGTGGCTCTGCTTGCACGGGCTCAAGCCCCTCCTGCCATTGACCGCTGTGCAACGC[T/C]
GATAGACACCACCGTCGCTAGCTCAGTTCAGAGAGAGAGAGATGGAGGTGAGGGAAGGGAAGGGACAAAAGAGAGAGGATGGGATCGGAAATCCTGTTTG

Reverse complement sequence

CAAACAGGATTTCCGATCCCATCCTCTCTCTTTTGTCCCTTCCCTTCCCTCACCTCCATCTCTCTCTCTCTGAACTGAGCTAGCGACGGTGGTGTCTATC[A/G]
GCGTTGCACAGCGGTCAATGGCAGGAGGGGCTTGAGCCCGTGCAAGCAGAGCCACGGGCGCCGATAGAGGCAGCAGGTGGCGCACGTCTCGCATCTCGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	13.30%	0.30%	23.87%	NA
All Indica	2759	61.50%	1.40%	0.25%	36.75%	NA
All Japonica	1512	63.70%	35.70%	0.26%	0.33%	NA
Aus	269	64.30%	1.10%	0.74%	33.83%	NA
Indica I	595	90.30%	2.20%	0.00%	7.56%	NA
Indica II	465	52.00%	1.70%	0.00%	46.24%	NA
Indica III	913	50.60%	0.30%	0.33%	48.74%	NA
Indica Intermediate	786	58.10%	2.00%	0.51%	39.31%	NA
Temperate Japonica	767	36.80%	62.50%	0.26%	0.52%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	78.00%	20.70%	0.83%	0.41%	NA
VI/Aromatic	96	66.70%	24.00%	1.04%	8.33%	NA
Intermediate	90	65.60%	23.30%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218122202	T -> C	LOC_Os12g30190.1	upstream_gene_variant ; 208.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1218122202	T -> C	LOC_Os12g30180.1	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1218122202	T -> C	LOC_Os12g30200.1	downstream_gene_variant ; 4417.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1218122202	T -> C	LOC_Os12g30190-LOC_Os12g30200	intergenic_region ; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1218122202	T -> DEL	N	N	silent_mutation	Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218122202	NA	6.66E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	7.93E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	6.58E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	1.10E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	5.66E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	1.22E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	4.59E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	2.71E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	5.29E-08	6.84E-11	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	3.40E-13	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	1.89E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	1.04E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	8.39E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	1.84E-11	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	NA	8.20E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	1.71E-07	9.06E-12	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	8.10E-07	1.12E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202	7.30E-07	4.96E-19	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251