\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218122202:

Variant ID: vg1218122202 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18122202
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGAGATGCGAGACGTGCGCCACCTGCTGCCTCTATCGGCGCCCGTGGCTCTGCTTGCACGGGCTCAAGCCCCTCCTGCCATTGACCGCTGTGCAACGC[T/C]
GATAGACACCACCGTCGCTAGCTCAGTTCAGAGAGAGAGAGATGGAGGTGAGGGAAGGGAAGGGACAAAAGAGAGAGGATGGGATCGGAAATCCTGTTTG

Reverse complement sequence

CAAACAGGATTTCCGATCCCATCCTCTCTCTTTTGTCCCTTCCCTTCCCTCACCTCCATCTCTCTCTCTCTGAACTGAGCTAGCGACGGTGGTGTCTATC[A/G]
GCGTTGCACAGCGGTCAATGGCAGGAGGGGCTTGAGCCCGTGCAAGCAGAGCCACGGGCGCCGATAGAGGCAGCAGGTGGCGCACGTCTCGCATCTCGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 13.30% 0.30% 23.87% NA
All Indica  2759 61.50% 1.40% 0.25% 36.75% NA
All Japonica  1512 63.70% 35.70% 0.26% 0.33% NA
Aus  269 64.30% 1.10% 0.74% 33.83% NA
Indica I  595 90.30% 2.20% 0.00% 7.56% NA
Indica II  465 52.00% 1.70% 0.00% 46.24% NA
Indica III  913 50.60% 0.30% 0.33% 48.74% NA
Indica Intermediate  786 58.10% 2.00% 0.51% 39.31% NA
Temperate Japonica  767 36.80% 62.50% 0.26% 0.52% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 20.70% 0.83% 0.41% NA
VI/Aromatic  96 66.70% 24.00% 1.04% 8.33% NA
Intermediate  90 65.60% 23.30% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218122202 T -> C LOC_Os12g30190.1 upstream_gene_variant ; 208.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N
vg1218122202 T -> C LOC_Os12g30180.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N
vg1218122202 T -> C LOC_Os12g30200.1 downstream_gene_variant ; 4417.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N
vg1218122202 T -> C LOC_Os12g30190-LOC_Os12g30200 intergenic_region ; MODIFIER silent_mutation Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N
vg1218122202 T -> DEL N N silent_mutation Average:64.204; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218122202 NA 6.66E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 7.93E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 6.58E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 1.10E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 5.66E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 1.22E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 4.59E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 2.71E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 5.29E-08 6.84E-11 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 3.40E-13 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 1.89E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 1.04E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 8.39E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 1.84E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 NA 8.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 1.71E-07 9.06E-12 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 8.10E-07 1.12E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218122202 7.30E-07 4.96E-19 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251