\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218121777:

Variant ID: vg1218121777 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18121777
Reference Allele: CAGAlternative Allele: TAG,C
Primary Allele: CAGSecondary Allele: TAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGGCAGCGGCTCATCAATCCCACGAATAGGAGGTCGAGCTTGCTTGGGAGACGTCTCTGCAAGCTCATGGAGGGCATCCACCATCTCCTCCGGATTGG[CAG/TAG,C]
AGAGGCGAGGAGGAGGTGGGAGGTGGTGGAGAGGCTGCCGGGTGACCGACGCCGATAGCAGCACAATGGTGAGGCTTGGCGCTGGTGAAGCGAGTGCGGG

Reverse complement sequence

CCCGCACTCGCTTCACCAGCGCCAAGCCTCACCATTGTGCTGCTATCGGCGTCGGTCACCCGGCAGCCTCTCCACCACCTCCCACCTCCTCCTCGCCTCT[CTG/CTA,G]
CCAATCCGGAGGAGATGGTGGATGCCCTCCATGAGCTTGCAGAGACGTCTCCCAAGCAAGCTCGACCTCCTATTCGTGGGATTGATGAGCCGCTGCCTCG

Allele Frequencies:

Populations Population SizeFrequency of CAG(primary allele) Frequency of TAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.60% 0.06% 0.00% C: 0.02%
All Indica  2759 95.30% 4.70% 0.00% 0.00% NA
All Japonica  1512 91.80% 7.90% 0.20% 0.00% C: 0.07%
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.20% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 0.80% 0.39% 0.00% C: 0.13%
Tropical Japonica  504 80.60% 19.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218121777 CAG -> C LOC_Os12g30190.1 frameshift_variant ; p.Cys73fs; HIGH frameshift_variant Average:76.251; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N
vg1218121777 CAG -> TAG LOC_Os12g30190.1 missense_variant ; p.Cys73Tyr; MODERATE nonsynonymous_codon ; C73H Average:76.251; most accessible tissue: Zhenshan97 young leaf, score: 90.815 probably damaging +2.174 N N
vg1218121777 CAG -> TAG LOC_Os12g30190.1 missense_variant ; p.Cys73Tyr; MODERATE nonsynonymous_codon ; C73Y Average:76.251; most accessible tissue: Zhenshan97 young leaf, score: 90.815 possibly damaging +1.825 N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218121777 CAG C -0.05 -0.06 -0.03 -0.11 -0.07 -0.05
vg1218121777 CAG TAG -0.01 -0.01 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218121777 1.35E-06 5.62E-08 mr1060 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 1.15E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 8.84E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 1.30E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 2.34E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 6.76E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 3.87E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 1.89E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 6.39E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 5.36E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 4.89E-14 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 4.84E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 3.90E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 7.19E-07 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 5.39E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 4.70E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 2.02E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 3.48E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 5.47E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 7.96E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218121777 NA 3.20E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251