\
| Variant ID: vg1218120371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18120371 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGGCCTGAGAGGTGGCCAGACGCAGAGGTCATCGCTCAGGCTCTACGGCGAGATCACCGTCTCCACCGGCAAGGTCAGCGTCGACGTCGTCCCTGCAGC[G/A]
GCGCGCGGAATGGCCGCCGGCGTGGCCTATCCTGTGGCCAGGGGAGACGGCTGGATGGAGCTCAAGCTGGCCGAGTTTGCTGCCGACGAGAAGCTGCTCG
CGAGCAGCTTCTCGTCGGCAGCAAACTCGGCCAGCTTGAGCTCCATCCAGCCGTCTCCCCTGGCCACAGGATAGGCCACGCCGGCGGCCATTCCGCGCGC[C/T]
GCTGCAGGGACGACGTCGACGCTGACCTTGCCGGTGGAGACGGTGATCTCGCCGTAGAGCCTGAGCGATGACCTCTGCGTCTGGCCACCTCTCAGGCCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 4.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 5.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.80% | 8.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 10.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218120371 | G -> A | LOC_Os12g30180.1 | synonymous_variant ; p.Ala413Ala; LOW | synonymous_codon | Average:76.064; most accessible tissue: Zhenshan97 young leaf, score: 87.723 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218120371 | 3.20E-08 | 3.20E-08 | mr1321 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 4.63E-06 | 2.87E-06 | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 3.44E-08 | 3.44E-08 | mr1323 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 2.35E-07 | 6.91E-08 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 3.82E-07 | 6.91E-08 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 1.13E-06 | 1.99E-07 | mr1326 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 7.30E-07 | 3.68E-07 | mr1335 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 6.08E-06 | 4.69E-08 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 3.33E-06 | 3.33E-06 | mr1527 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | NA | 2.69E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | 5.92E-06 | 4.66E-06 | mr1712 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218120371 | NA | 2.99E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |