\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218119528:

Variant ID: vg1218119528 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18119528
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGACAATACTAGAAATTATTATATTGTAAAACGGAGGGAGTAGTACTGACAGACATTTACAGAATCTACTGTGGATTATACTTGGTACCGAACAATC[C/A,G]
AAATTTTTATATTGGTTGACGAACGCATGTAGAGTTTTTGGTTGGATGCTACAAGCAACGCCAAGTGCTACATGCTATCATCGAGATTATTAAAGGTTAC

Reverse complement sequence

GTAACCTTTAATAATCTCGATGATAGCATGTAGCACTTGGCGTTGCTTGTAGCATCCAACCAAAAACTCTACATGCGTTCGTCAACCAATATAAAAATTT[G/T,C]
GATTGTTCGGTACCAAGTATAATCCACAGTAGATTCTGTAAATGTCTGTCAGTACTACTCCCTCCGTTTTACAATATAATAATTTCTAGTATTGTCTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 5.00% 0.13% 0.00% G: 2.41%
All Indica  2759 93.60% 2.10% 0.14% 0.00% G: 4.13%
All Japonica  1512 92.70% 7.30% 0.00% 0.00% NA
Aus  269 77.30% 21.90% 0.74% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.00% G: 0.17%
Indica II  465 88.40% 9.20% 0.00% 0.00% G: 2.37%
Indica III  913 91.20% 0.20% 0.11% 0.00% G: 8.43%
Indica Intermediate  786 94.80% 1.70% 0.38% 0.00% G: 3.18%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 80.40% 19.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218119528 C -> A LOC_Os12g30190.1 downstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Callus, score: 88.864 N N N N
vg1218119528 C -> A LOC_Os12g30180.1 intron_variant ; MODIFIER silent_mutation Average:59.146; most accessible tissue: Callus, score: 88.864 N N N N
vg1218119528 C -> G LOC_Os12g30190.1 downstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Callus, score: 88.864 N N N N
vg1218119528 C -> G LOC_Os12g30180.1 intron_variant ; MODIFIER silent_mutation Average:59.146; most accessible tissue: Callus, score: 88.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218119528 NA 3.43E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 4.72E-06 NA mr1217 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 2.84E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 1.79E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 6.51E-06 NA mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 2.94E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 2.68E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 1.38E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 8.13E-06 NA mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 2.43E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 4.64E-06 NA mr1845 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 4.62E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 4.85E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218119528 NA 1.39E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251