\
| Variant ID: vg1218119528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18119528 |
| Reference Allele: C | Alternative Allele: A,G |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )
TATAGACAATACTAGAAATTATTATATTGTAAAACGGAGGGAGTAGTACTGACAGACATTTACAGAATCTACTGTGGATTATACTTGGTACCGAACAATC[C/A,G]
AAATTTTTATATTGGTTGACGAACGCATGTAGAGTTTTTGGTTGGATGCTACAAGCAACGCCAAGTGCTACATGCTATCATCGAGATTATTAAAGGTTAC
GTAACCTTTAATAATCTCGATGATAGCATGTAGCACTTGGCGTTGCTTGTAGCATCCAACCAAAAACTCTACATGCGTTCGTCAACCAATATAAAAATTT[G/T,C]
GATTGTTCGGTACCAAGTATAATCCACAGTAGATTCTGTAAATGTCTGTCAGTACTACTCCCTCCGTTTTACAATATAATAATTTCTAGTATTGTCTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 5.00% | 0.13% | 0.00% | G: 2.41% |
| All Indica | 2759 | 93.60% | 2.10% | 0.14% | 0.00% | G: 4.13% |
| All Japonica | 1512 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.30% | 21.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.00% | G: 0.17% |
| Indica II | 465 | 88.40% | 9.20% | 0.00% | 0.00% | G: 2.37% |
| Indica III | 913 | 91.20% | 0.20% | 0.11% | 0.00% | G: 8.43% |
| Indica Intermediate | 786 | 94.80% | 1.70% | 0.38% | 0.00% | G: 3.18% |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218119528 | C -> A | LOC_Os12g30190.1 | downstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:59.146; most accessible tissue: Callus, score: 88.864 | N | N | N | N |
| vg1218119528 | C -> A | LOC_Os12g30180.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.146; most accessible tissue: Callus, score: 88.864 | N | N | N | N |
| vg1218119528 | C -> G | LOC_Os12g30190.1 | downstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:59.146; most accessible tissue: Callus, score: 88.864 | N | N | N | N |
| vg1218119528 | C -> G | LOC_Os12g30180.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.146; most accessible tissue: Callus, score: 88.864 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218119528 | NA | 3.43E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | 4.72E-06 | NA | mr1217 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 2.84E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 1.79E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | 6.51E-06 | NA | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 2.94E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 2.68E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 1.38E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | 8.13E-06 | NA | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 2.43E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | 4.64E-06 | NA | mr1845 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 4.62E-06 | mr1884 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 4.85E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218119528 | NA | 1.39E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |