\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218110271:

Variant ID: vg1218110271 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18110271
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CCACAAAATTTTATTTGGTCATTTCAGATTTGCTAAAGTTCTACTAGTAGTTATTTCTTTCCGTTTGTTTTAAACTCCAACTTTAAACTTCAACTTTCTC[T/G]
TTTTCCATTAGCACACTTTCCAAACTTCTAGATATTGTATTTTTGATAAAAAGAATATATAAAAGTTTCTTTAAAAATCAAATGAACCTATTTTTCAAAT

Reverse complement sequence

ATTTGAAAAATAGGTTCATTTGATTTTTAAAGAAACTTTTATATATTCTTTTTATCAAAAATACAATATCTAGAAGTTTGGAAAGTGTGCTAATGGAAAA[A/C]
GAGAAAGTTGAAGTTTAAAGTTGGAGTTTAAAACAAACGGAAAGAAATAACTACTAGTAGAACTTTAGCAAATCTGAAATGACCAAATAAAATTTTGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 12.90% 1.93% 31.46% NA
All Indica  2759 53.50% 1.70% 1.99% 42.84% NA
All Japonica  1512 58.10% 35.50% 0.46% 5.95% NA
Aus  269 24.50% 1.10% 10.41% 63.94% NA
Indica I  595 83.20% 2.70% 2.69% 11.43% NA
Indica II  465 49.20% 1.90% 0.65% 48.17% NA
Indica III  913 38.20% 0.20% 2.41% 59.15% NA
Indica Intermediate  786 51.30% 2.40% 1.78% 44.53% NA
Temperate Japonica  767 36.50% 62.10% 0.52% 0.91% NA
Tropical Japonica  504 93.50% 2.00% 0.40% 4.17% NA
Japonica Intermediate  241 52.70% 21.20% 0.41% 25.73% NA
VI/Aromatic  96 72.90% 1.00% 1.04% 25.00% NA
Intermediate  90 55.60% 23.30% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218110271 T -> DEL N N silent_mutation Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg1218110271 T -> G LOC_Os12g30170.1 upstream_gene_variant ; 894.0bp to feature; MODIFIER silent_mutation Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg1218110271 T -> G LOC_Os12g30160.1 downstream_gene_variant ; 272.0bp to feature; MODIFIER silent_mutation Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg1218110271 T -> G LOC_Os12g30160-LOC_Os12g30170 intergenic_region ; MODIFIER silent_mutation Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218110271 NA 3.60E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.54E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 6.25E-07 2.33E-08 mr1171 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 9.69E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.35E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 7.96E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 6.47E-06 6.46E-06 mr1356 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 2.11E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 2.26E-07 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.56E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.83E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 4.09E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 4.89E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.27E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 2.89E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 5.94E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.74E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 8.95E-08 1.36E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.10E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 7.48E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 5.70E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 2.53E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 7.43E-06 7.42E-06 mr1779 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 4.77E-06 2.06E-07 mr1786 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 3.12E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 3.12E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 1.13E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 3.49E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 5.15E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218110271 NA 3.27E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251