\
| Variant ID: vg1218110271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18110271 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 116. )
CCACAAAATTTTATTTGGTCATTTCAGATTTGCTAAAGTTCTACTAGTAGTTATTTCTTTCCGTTTGTTTTAAACTCCAACTTTAAACTTCAACTTTCTC[T/G]
TTTTCCATTAGCACACTTTCCAAACTTCTAGATATTGTATTTTTGATAAAAAGAATATATAAAAGTTTCTTTAAAAATCAAATGAACCTATTTTTCAAAT
ATTTGAAAAATAGGTTCATTTGATTTTTAAAGAAACTTTTATATATTCTTTTTATCAAAAATACAATATCTAGAAGTTTGGAAAGTGTGCTAATGGAAAA[A/C]
GAGAAAGTTGAAGTTTAAAGTTGGAGTTTAAAACAAACGGAAAGAAATAACTACTAGTAGAACTTTAGCAAATCTGAAATGACCAAATAAAATTTTGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 12.90% | 1.93% | 31.46% | NA |
| All Indica | 2759 | 53.50% | 1.70% | 1.99% | 42.84% | NA |
| All Japonica | 1512 | 58.10% | 35.50% | 0.46% | 5.95% | NA |
| Aus | 269 | 24.50% | 1.10% | 10.41% | 63.94% | NA |
| Indica I | 595 | 83.20% | 2.70% | 2.69% | 11.43% | NA |
| Indica II | 465 | 49.20% | 1.90% | 0.65% | 48.17% | NA |
| Indica III | 913 | 38.20% | 0.20% | 2.41% | 59.15% | NA |
| Indica Intermediate | 786 | 51.30% | 2.40% | 1.78% | 44.53% | NA |
| Temperate Japonica | 767 | 36.50% | 62.10% | 0.52% | 0.91% | NA |
| Tropical Japonica | 504 | 93.50% | 2.00% | 0.40% | 4.17% | NA |
| Japonica Intermediate | 241 | 52.70% | 21.20% | 0.41% | 25.73% | NA |
| VI/Aromatic | 96 | 72.90% | 1.00% | 1.04% | 25.00% | NA |
| Intermediate | 90 | 55.60% | 23.30% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218110271 | T -> DEL | N | N | silent_mutation | Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1218110271 | T -> G | LOC_Os12g30170.1 | upstream_gene_variant ; 894.0bp to feature; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1218110271 | T -> G | LOC_Os12g30160.1 | downstream_gene_variant ; 272.0bp to feature; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg1218110271 | T -> G | LOC_Os12g30160-LOC_Os12g30170 | intergenic_region ; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218110271 | NA | 3.60E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.54E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | 6.25E-07 | 2.33E-08 | mr1171 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 9.69E-07 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.35E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 7.96E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | 6.47E-06 | 6.46E-06 | mr1356 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 2.11E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 2.26E-07 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.56E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.83E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 4.09E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 4.89E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.27E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 2.89E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 5.94E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.74E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | 8.95E-08 | 1.36E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.10E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 7.48E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 5.70E-08 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 2.53E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | 7.43E-06 | 7.42E-06 | mr1779 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | 4.77E-06 | 2.06E-07 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 3.12E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 3.12E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 1.13E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 3.49E-06 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 5.15E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218110271 | NA | 3.27E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |