\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218108461:

Variant ID: vg1218108461 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18108461
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACGTTTTGTTTCTTTGTCCGGCCCACAGTATAGATGCGAAAGTATTCTTTTTTTTTAAAAAAAAATAACACATCTAATCTAATAGTCTAAAGTATTGG[G/A]
TCCACCAATTTAAATGAAAATCGACGGTGAGATTTAACAGTGCCATGTGGCGGTCTAGGAGTATTTATAGGAACGTCACGTGGCGGTTTGAGAGCGTTTC

Reverse complement sequence

GAAACGCTCTCAAACCGCCACGTGACGTTCCTATAAATACTCCTAGACCGCCACATGGCACTGTTAAATCTCACCGTCGATTTTCATTTAAATTGGTGGA[C/T]
CCAATACTTTAGACTATTAGATTAGATGTGTTATTTTTTTTTAAAAAAAAAGAATACTTTCGCATCTATACTGTGGGCCGGACAAAGAAACAAAACGTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 4.00% 1.80% 4.36% NA
All Indica  2759 84.50% 6.60% 2.10% 6.81% NA
All Japonica  1512 97.00% 0.50% 1.59% 0.99% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 74.30% 5.90% 2.18% 17.65% NA
Indica II  465 92.30% 3.90% 1.08% 2.80% NA
Indica III  913 91.10% 6.00% 1.86% 0.99% NA
Indica Intermediate  786 79.90% 9.40% 2.93% 7.76% NA
Temperate Japonica  767 96.70% 0.10% 2.35% 0.78% NA
Tropical Japonica  504 97.40% 0.20% 0.79% 1.59% NA
Japonica Intermediate  241 96.70% 2.10% 0.83% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 1.10% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218108461 G -> DEL N N silent_mutation Average:34.25; most accessible tissue: Callus, score: 54.494 N N N N
vg1218108461 G -> A LOC_Os12g30160.1 upstream_gene_variant ; 411.0bp to feature; MODIFIER silent_mutation Average:34.25; most accessible tissue: Callus, score: 54.494 N N N N
vg1218108461 G -> A LOC_Os12g30170.1 upstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:34.25; most accessible tissue: Callus, score: 54.494 N N N N
vg1218108461 G -> A LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER silent_mutation Average:34.25; most accessible tissue: Callus, score: 54.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218108461 1.49E-06 NA mr1176 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 5.19E-06 NA mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 6.55E-06 NA mr1265 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 7.96E-06 NA mr1320 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.63E-09 1.63E-09 mr1321 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 5.48E-06 NA mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 4.65E-07 4.65E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.11E-07 1.32E-08 mr1324 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 3.87E-07 7.75E-08 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.38E-06 6.01E-07 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 5.91E-06 5.66E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 9.87E-07 1.61E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 NA 5.22E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 2.07E-06 NA mr1438 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.64E-06 NA mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 9.47E-06 NA mr1520 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 5.28E-06 NA mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 6.29E-06 6.30E-06 mr1539 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 6.48E-06 6.48E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 5.66E-06 5.66E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 4.39E-08 3.87E-08 mr1621 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 6.71E-07 NA mr1630 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 4.31E-06 NA mr1712 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.33E-06 1.20E-06 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.50E-06 1.45E-06 mr1755 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 7.12E-06 NA mr1879 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461 1.19E-06 1.13E-06 mr1965 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251