| Variant ID: vg1218108461 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18108461 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACGTTTTGTTTCTTTGTCCGGCCCACAGTATAGATGCGAAAGTATTCTTTTTTTTTAAAAAAAAATAACACATCTAATCTAATAGTCTAAAGTATTGG[G/A]
TCCACCAATTTAAATGAAAATCGACGGTGAGATTTAACAGTGCCATGTGGCGGTCTAGGAGTATTTATAGGAACGTCACGTGGCGGTTTGAGAGCGTTTC
GAAACGCTCTCAAACCGCCACGTGACGTTCCTATAAATACTCCTAGACCGCCACATGGCACTGTTAAATCTCACCGTCGATTTTCATTTAAATTGGTGGA[C/T]
CCAATACTTTAGACTATTAGATTAGATGTGTTATTTTTTTTTAAAAAAAAAGAATACTTTCGCATCTATACTGTGGGCCGGACAAAGAAACAAAACGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 4.00% | 1.80% | 4.36% | NA |
| All Indica | 2759 | 84.50% | 6.60% | 2.10% | 6.81% | NA |
| All Japonica | 1512 | 97.00% | 0.50% | 1.59% | 0.99% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 74.30% | 5.90% | 2.18% | 17.65% | NA |
| Indica II | 465 | 92.30% | 3.90% | 1.08% | 2.80% | NA |
| Indica III | 913 | 91.10% | 6.00% | 1.86% | 0.99% | NA |
| Indica Intermediate | 786 | 79.90% | 9.40% | 2.93% | 7.76% | NA |
| Temperate Japonica | 767 | 96.70% | 0.10% | 2.35% | 0.78% | NA |
| Tropical Japonica | 504 | 97.40% | 0.20% | 0.79% | 1.59% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218108461 | G -> DEL | N | N | silent_mutation | Average:34.25; most accessible tissue: Callus, score: 54.494 | N | N | N | N |
| vg1218108461 | G -> A | LOC_Os12g30160.1 | upstream_gene_variant ; 411.0bp to feature; MODIFIER | silent_mutation | Average:34.25; most accessible tissue: Callus, score: 54.494 | N | N | N | N |
| vg1218108461 | G -> A | LOC_Os12g30170.1 | upstream_gene_variant ; 2704.0bp to feature; MODIFIER | silent_mutation | Average:34.25; most accessible tissue: Callus, score: 54.494 | N | N | N | N |
| vg1218108461 | G -> A | LOC_Os12g30150-LOC_Os12g30160 | intergenic_region ; MODIFIER | silent_mutation | Average:34.25; most accessible tissue: Callus, score: 54.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218108461 | 1.49E-06 | NA | mr1176 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 5.19E-06 | NA | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 6.55E-06 | NA | mr1265 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 7.96E-06 | NA | mr1320 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 1.63E-09 | 1.63E-09 | mr1321 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 5.48E-06 | NA | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 4.65E-07 | 4.65E-07 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 1.11E-07 | 1.32E-08 | mr1324 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 3.87E-07 | 7.75E-08 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108461 | 1.38E-06 | 6.01E-07 | mr1326 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/