Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218108461:

Variant ID: vg1218108461 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18108461
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACGTTTTGTTTCTTTGTCCGGCCCACAGTATAGATGCGAAAGTATTCTTTTTTTTTAAAAAAAAATAACACATCTAATCTAATAGTCTAAAGTATTGG[G/A]
TCCACCAATTTAAATGAAAATCGACGGTGAGATTTAACAGTGCCATGTGGCGGTCTAGGAGTATTTATAGGAACGTCACGTGGCGGTTTGAGAGCGTTTC

Reverse complement sequence

GAAACGCTCTCAAACCGCCACGTGACGTTCCTATAAATACTCCTAGACCGCCACATGGCACTGTTAAATCTCACCGTCGATTTTCATTTAAATTGGTGGA[C/T]
CCAATACTTTAGACTATTAGATTAGATGTGTTATTTTTTTTTAAAAAAAAAGAATACTTTCGCATCTATACTGTGGGCCGGACAAAGAAACAAAACGTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	4.00%	1.80%	4.36%	NA
All Indica	2759	84.50%	6.60%	2.10%	6.81%	NA
All Japonica	1512	97.00%	0.50%	1.59%	0.99%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	74.30%	5.90%	2.18%	17.65%	NA
Indica II	465	92.30%	3.90%	1.08%	2.80%	NA
Indica III	913	91.10%	6.00%	1.86%	0.99%	NA
Indica Intermediate	786	79.90%	9.40%	2.93%	7.76%	NA
Temperate Japonica	767	96.70%	0.10%	2.35%	0.78%	NA
Tropical Japonica	504	97.40%	0.20%	0.79%	1.59%	NA
Japonica Intermediate	241	96.70%	2.10%	0.83%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	1.10%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218108461	G -> DEL	N	N	silent_mutation	Average:34.25; most accessible tissue: Callus, score: 54.494	N	N	N	N
vg1218108461	G -> A	LOC_Os12g30160.1	upstream_gene_variant ; 411.0bp to feature; MODIFIER	silent_mutation	Average:34.25; most accessible tissue: Callus, score: 54.494	N	N	N	N
vg1218108461	G -> A	LOC_Os12g30170.1	upstream_gene_variant ; 2704.0bp to feature; MODIFIER	silent_mutation	Average:34.25; most accessible tissue: Callus, score: 54.494	N	N	N	N
vg1218108461	G -> A	LOC_Os12g30150-LOC_Os12g30160	intergenic_region ; MODIFIER	silent_mutation	Average:34.25; most accessible tissue: Callus, score: 54.494	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218108461	1.49E-06	NA	mr1176	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	5.19E-06	NA	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	6.55E-06	NA	mr1265	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	7.96E-06	NA	mr1320	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.63E-09	1.63E-09	mr1321	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	5.48E-06	NA	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	4.65E-07	4.65E-07	mr1323	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.11E-07	1.32E-08	mr1324	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	3.87E-07	7.75E-08	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.38E-06	6.01E-07	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	5.91E-06	5.66E-06	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	9.87E-07	1.61E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	NA	5.22E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	2.07E-06	NA	mr1438	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.64E-06	NA	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	9.47E-06	NA	mr1520	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	5.28E-06	NA	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	6.29E-06	6.30E-06	mr1539	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	6.48E-06	6.48E-06	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	5.66E-06	5.66E-06	mr1545	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	4.39E-08	3.87E-08	mr1621	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	6.71E-07	NA	mr1630	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	4.31E-06	NA	mr1712	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.33E-06	1.20E-06	mr1732	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.50E-06	1.45E-06	mr1755	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	7.12E-06	NA	mr1879	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108461	1.19E-06	1.13E-06	mr1965	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251