\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218107451:

Variant ID: vg1218107451 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18107451
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGATTGATCCGCCTCGTTGTCTCATCGGGAGAGAGGCATTGGTGATGGGGATCGATTAAAAACCGTGGTGGGACGACATGCTATGGTAGACATAGCTG[C/T]
GGCCATATTTGTTGGCCAAGTTCTAGATGGCAGGGGTGTAGCAGAACCTGGCCATTGAGGACCAGCGCAGGTTCTCGCCTCCGGTACCTGCAACTCTCAT

Reverse complement sequence

ATGAGAGTTGCAGGTACCGGAGGCGAGAACCTGCGCTGGTCCTCAATGGCCAGGTTCTGCTACACCCCTGCCATCTAGAACTTGGCCAACAAATATGGCC[G/A]
CAGCTATGTCTACCATAGCATGTCGTCCCACCACGGTTTTTAATCGATCCCCATCACCAATGCCTCTCTCCCGATGAGACAACGAGGCGGATCAATCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 0.70% 2.41% 0.30% NA
All Indica  2759 94.60% 1.10% 3.91% 0.36% NA
All Japonica  1512 99.30% 0.10% 0.33% 0.26% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 95.10% 0.80% 3.53% 0.50% NA
Indica II  465 95.50% 1.50% 2.37% 0.65% NA
Indica III  913 96.20% 1.20% 2.63% 0.00% NA
Indica Intermediate  786 91.90% 1.00% 6.62% 0.51% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.20% 0.79% NA
Japonica Intermediate  241 98.30% 0.40% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218107451 C -> DEL N N silent_mutation Average:31.33; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg1218107451 C -> T LOC_Os12g30160.1 upstream_gene_variant ; 1421.0bp to feature; MODIFIER silent_mutation Average:31.33; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg1218107451 C -> T LOC_Os12g30170.1 upstream_gene_variant ; 3714.0bp to feature; MODIFIER silent_mutation Average:31.33; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg1218107451 C -> T LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER silent_mutation Average:31.33; most accessible tissue: Minghui63 root, score: 47.894 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218107451 6.56E-08 6.56E-08 mr1321 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 1.93E-06 3.66E-06 mr1322 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 2.31E-07 2.31E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 1.84E-07 2.59E-08 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 2.47E-08 4.00E-09 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 3.35E-07 6.90E-08 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 2.98E-06 4.68E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 2.17E-06 7.08E-08 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 4.78E-06 NA mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 8.85E-06 8.86E-06 mr1527 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 1.17E-06 1.17E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 NA 1.02E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 7.78E-07 1.10E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 1.14E-06 3.86E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107451 6.06E-06 NA mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251