\
| Variant ID: vg1218088617 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18088617 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGTCCCGGTTCCATTAAAAACCGGGACTAAAAATGATTTTTAGTCCCGGTTAATAAGAGGAAGATCTTTAATCCCGGTTGTTGTTCTTTAGTCCCGGTTG[A/G]
TAACTCCAACCGGGACTAAAGTTCATTTTTAGTCCCGGTTGATTCCATGTCAGGCCGTGTCAGGGCTCTAGGATCTTTAGTCCCGGTTAATAACACCAAC
GTTGGTGTTATTAACCGGGACTAAAGATCCTAGAGCCCTGACACGGCCTGACATGGAATCAACCGGGACTAAAAATGAACTTTAGTCCCGGTTGGAGTTA[T/C]
CAACCGGGACTAAAGAACAACAACCGGGATTAAAGATCTTCCTCTTATTAACCGGGACTAAAAATCATTTTTAGTCCCGGTTTTTAATGGAACCGGGACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 32.60% | 23.99% | 2.71% | NA |
| All Indica | 2759 | 43.10% | 23.20% | 29.10% | 4.57% | NA |
| All Japonica | 1512 | 44.50% | 50.90% | 4.50% | 0.07% | NA |
| Aus | 269 | 4.80% | 13.80% | 81.41% | 0.00% | NA |
| Indica I | 595 | 81.30% | 9.20% | 8.57% | 0.84% | NA |
| Indica II | 465 | 25.20% | 25.60% | 41.51% | 7.74% | NA |
| Indica III | 913 | 28.00% | 30.60% | 36.36% | 5.04% | NA |
| Indica Intermediate | 786 | 42.40% | 23.80% | 28.88% | 4.96% | NA |
| Temperate Japonica | 767 | 64.40% | 30.80% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 22.20% | 76.60% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.80% | 61.40% | 10.37% | 0.41% | NA |
| VI/Aromatic | 96 | 5.20% | 63.50% | 31.25% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 37.80% | 15.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218088617 | A -> DEL | N | N | silent_mutation | Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg1218088617 | A -> G | LOC_Os12g30140.1 | upstream_gene_variant ; 2190.0bp to feature; MODIFIER | silent_mutation | Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg1218088617 | A -> G | LOC_Os12g30130-LOC_Os12g30140 | intergenic_region ; MODIFIER | silent_mutation | Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218088617 | NA | 5.51E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 7.20E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 4.93E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 4.56E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 2.71E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | 1.16E-06 | NA | mr1328 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 1.13E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | 5.84E-06 | NA | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 5.02E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 1.21E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 6.03E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 7.90E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 6.70E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218088617 | NA | 6.70E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |