Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218088617:

Variant ID: vg1218088617 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18088617
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTCCCGGTTCCATTAAAAACCGGGACTAAAAATGATTTTTAGTCCCGGTTAATAAGAGGAAGATCTTTAATCCCGGTTGTTGTTCTTTAGTCCCGGTTG[A/G]
TAACTCCAACCGGGACTAAAGTTCATTTTTAGTCCCGGTTGATTCCATGTCAGGCCGTGTCAGGGCTCTAGGATCTTTAGTCCCGGTTAATAACACCAAC

Reverse complement sequence

GTTGGTGTTATTAACCGGGACTAAAGATCCTAGAGCCCTGACACGGCCTGACATGGAATCAACCGGGACTAAAAATGAACTTTAGTCCCGGTTGGAGTTA[T/C]
CAACCGGGACTAAAGAACAACAACCGGGATTAAAGATCTTCCTCTTATTAACCGGGACTAAAAATCATTTTTAGTCCCGGTTTTTAATGGAACCGGGACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.70%	32.60%	23.99%	2.71%	NA
All Indica	2759	43.10%	23.20%	29.10%	4.57%	NA
All Japonica	1512	44.50%	50.90%	4.50%	0.07%	NA
Aus	269	4.80%	13.80%	81.41%	0.00%	NA
Indica I	595	81.30%	9.20%	8.57%	0.84%	NA
Indica II	465	25.20%	25.60%	41.51%	7.74%	NA
Indica III	913	28.00%	30.60%	36.36%	5.04%	NA
Indica Intermediate	786	42.40%	23.80%	28.88%	4.96%	NA
Temperate Japonica	767	64.40%	30.80%	4.82%	0.00%	NA
Tropical Japonica	504	22.20%	76.60%	1.19%	0.00%	NA
Japonica Intermediate	241	27.80%	61.40%	10.37%	0.41%	NA
VI/Aromatic	96	5.20%	63.50%	31.25%	0.00%	NA
Intermediate	90	45.60%	37.80%	15.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218088617	A -> DEL	N	N	silent_mutation	Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1218088617	A -> G	LOC_Os12g30140.1	upstream_gene_variant ; 2190.0bp to feature; MODIFIER	silent_mutation	Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1218088617	A -> G	LOC_Os12g30130-LOC_Os12g30140	intergenic_region ; MODIFIER	silent_mutation	Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218088617	NA	5.51E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	7.20E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	4.93E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	4.56E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	2.71E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	1.16E-06	NA	mr1328	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	1.13E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	5.84E-06	NA	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	5.02E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	1.21E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	6.03E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	7.90E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	6.70E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617	NA	6.70E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251