\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218088617:

Variant ID: vg1218088617 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18088617
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCCCGGTTCCATTAAAAACCGGGACTAAAAATGATTTTTAGTCCCGGTTAATAAGAGGAAGATCTTTAATCCCGGTTGTTGTTCTTTAGTCCCGGTTG[A/G]
TAACTCCAACCGGGACTAAAGTTCATTTTTAGTCCCGGTTGATTCCATGTCAGGCCGTGTCAGGGCTCTAGGATCTTTAGTCCCGGTTAATAACACCAAC

Reverse complement sequence

GTTGGTGTTATTAACCGGGACTAAAGATCCTAGAGCCCTGACACGGCCTGACATGGAATCAACCGGGACTAAAAATGAACTTTAGTCCCGGTTGGAGTTA[T/C]
CAACCGGGACTAAAGAACAACAACCGGGATTAAAGATCTTCCTCTTATTAACCGGGACTAAAAATCATTTTTAGTCCCGGTTTTTAATGGAACCGGGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 32.60% 23.99% 2.71% NA
All Indica  2759 43.10% 23.20% 29.10% 4.57% NA
All Japonica  1512 44.50% 50.90% 4.50% 0.07% NA
Aus  269 4.80% 13.80% 81.41% 0.00% NA
Indica I  595 81.30% 9.20% 8.57% 0.84% NA
Indica II  465 25.20% 25.60% 41.51% 7.74% NA
Indica III  913 28.00% 30.60% 36.36% 5.04% NA
Indica Intermediate  786 42.40% 23.80% 28.88% 4.96% NA
Temperate Japonica  767 64.40% 30.80% 4.82% 0.00% NA
Tropical Japonica  504 22.20% 76.60% 1.19% 0.00% NA
Japonica Intermediate  241 27.80% 61.40% 10.37% 0.41% NA
VI/Aromatic  96 5.20% 63.50% 31.25% 0.00% NA
Intermediate  90 45.60% 37.80% 15.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218088617 A -> DEL N N silent_mutation Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1218088617 A -> G LOC_Os12g30140.1 upstream_gene_variant ; 2190.0bp to feature; MODIFIER silent_mutation Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1218088617 A -> G LOC_Os12g30130-LOC_Os12g30140 intergenic_region ; MODIFIER silent_mutation Average:25.75; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218088617 NA 5.51E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 7.20E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 4.93E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 4.56E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 2.71E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 1.16E-06 NA mr1328 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 1.13E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 5.84E-06 NA mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 5.02E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 1.21E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 6.03E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 7.90E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 6.70E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218088617 NA 6.70E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251