\
| Variant ID: vg1218087139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18087139 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, C: 0.43, others allele: 0.00, population size: 77. )
GGATATTAATTTGTTATATTGTTCCAAAATTTACCCTCTTTTTTTTCCTCAAAAATTGAAATTGAGCACAGACATTCCACGTGACTAATTAACCAATCTG[C/G,T]
TCCTTCAACTCTAGTATGATTTTCCATATAGTTTAGTAATTTCAACAGAAGAGTACACATACGCATGCGGGAGATTTCTTACTGACTATAAAAATAATGT
ACATTATTTTTATAGTCAGTAAGAAATCTCCCGCATGCGTATGTGTACTCTTCTGTTGAAATTACTAAACTATATGGAAAATCATACTAGAGTTGAAGGA[G/C,A]
CAGATTGGTTAATTAGTCACGTGGAATGTCTGTGCTCAATTTCAATTTTTGAGGAAAAAAAAGAGGGTAAATTTTGGAACAATATAACAAATTAATATCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.60% | 22.90% | 1.18% | 33.90% | T: 0.49% |
| All Indica | 2759 | 47.30% | 7.80% | 1.59% | 42.48% | T: 0.83% |
| All Japonica | 1512 | 37.40% | 49.60% | 0.33% | 12.70% | NA |
| Aus | 269 | 19.00% | 8.20% | 1.49% | 71.38% | NA |
| Indica I | 595 | 82.40% | 3.40% | 0.34% | 13.95% | NA |
| Indica II | 465 | 36.80% | 6.90% | 1.94% | 53.98% | T: 0.43% |
| Indica III | 913 | 30.20% | 10.10% | 2.08% | 55.42% | T: 2.19% |
| Indica Intermediate | 786 | 46.70% | 9.20% | 1.78% | 42.24% | T: 0.13% |
| Temperate Japonica | 767 | 63.90% | 34.60% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 3.20% | 73.40% | 0.40% | 23.02% | NA |
| Japonica Intermediate | 241 | 24.50% | 47.70% | 0.41% | 27.39% | NA |
| VI/Aromatic | 96 | 2.10% | 67.70% | 1.04% | 29.17% | NA |
| Intermediate | 90 | 46.70% | 31.10% | 2.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218087139 | C -> DEL | N | N | silent_mutation | Average:20.323; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg1218087139 | C -> G | LOC_Os12g30140.1 | upstream_gene_variant ; 3668.0bp to feature; MODIFIER | silent_mutation | Average:20.323; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg1218087139 | C -> G | LOC_Os12g30130-LOC_Os12g30140 | intergenic_region ; MODIFIER | silent_mutation | Average:20.323; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg1218087139 | C -> T | LOC_Os12g30140.1 | upstream_gene_variant ; 3668.0bp to feature; MODIFIER | silent_mutation | Average:20.323; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg1218087139 | C -> T | LOC_Os12g30130-LOC_Os12g30140 | intergenic_region ; MODIFIER | silent_mutation | Average:20.323; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218087139 | NA | 1.64E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 9.54E-06 | 1.52E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 1.59E-06 | NA | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 5.62E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.91E-12 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 2.45E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 9.47E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 6.98E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 6.02E-14 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 4.31E-06 | 4.31E-09 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.20E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 2.53E-09 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 3.38E-08 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 5.67E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 3.62E-06 | 3.63E-06 | mr1356 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 6.61E-06 | 8.69E-06 | mr1359 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.40E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 1.32E-06 | 1.89E-10 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 2.46E-06 | 1.07E-10 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.42E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 6.96E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 9.36E-11 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 2.01E-06 | 1.43E-08 | mr1492 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 2.61E-11 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 4.65E-06 | 1.08E-08 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.54E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.07E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.28E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.65E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 7.24E-06 | NA | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.64E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 4.18E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.68E-09 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 3.50E-06 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 6.41E-14 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 1.28E-06 | 7.51E-12 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 1.51E-06 | 1.01E-11 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 1.51E-06 | 1.01E-11 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.15E-06 | mr1802 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.16E-06 | mr1809 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 5.23E-06 | 5.87E-11 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 9.20E-07 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 2.71E-07 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 4.66E-06 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 8.72E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.46E-09 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 2.77E-07 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 1.04E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | NA | 6.02E-08 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 9.32E-06 | 3.06E-06 | mr1948 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218087139 | 8.08E-06 | 4.75E-09 | mr1992 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |