Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218084463:

Variant ID: vg1218084463 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18084463
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAGCAGCTTACTGAGGTGTGCTGCAGCCCTCCCTCAAGTGCTCATGGGCACGTGATACGAGGAGGTGGGCCACACCAGTACCTAAGTTGGTAACATCA[C/T]
GGTATGATAAAGCTGCACAAATCAATACATTCATTTGTGCATACTCACGGTGAGAAGACATGGGGCTTTCTAATATTACATTTTTTTATCTTTATCGTTC

Reverse complement sequence

GAACGATAAAGATAAAAAAATGTAATATTAGAAAGCCCCATGTCTTCTCACCGTGAGTATGCACAAATGAATGTATTGATTTGTGCAGCTTTATCATACC[G/A]
TGATGTTACCAACTTAGGTACTGGTGTGGCCCACCTCCTCGTATCACGTGCCCATGAGCACTTGAGGGAGGGCTGCAGCACACCTCAGTAAGCTGCTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.10% 0.36% 0.02% NA
All Indica  2759 58.60% 41.00% 0.36% 0.04% NA
All Japonica  1512 42.60% 57.30% 0.13% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 17.10% 82.50% 0.34% 0.00% NA
Indica II  465 77.40% 22.20% 0.43% 0.00% NA
Indica III  913 76.10% 23.80% 0.11% 0.00% NA
Indica Intermediate  786 58.40% 40.80% 0.64% 0.13% NA
Temperate Japonica  767 64.80% 35.10% 0.13% 0.00% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 46.50% 53.10% 0.41% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 52.20% 42.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218084463 C -> DEL N N silent_mutation Average:73.375; most accessible tissue: Callus, score: 92.933 N N N N
vg1218084463 C -> T LOC_Os12g30130-LOC_Os12g30140 intergenic_region ; MODIFIER silent_mutation Average:73.375; most accessible tissue: Callus, score: 92.933 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218084463 C T -0.04 -0.03 -0.02 -0.05 -0.09 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218084463 NA 2.49E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 5.60E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 2.68E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 1.75E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 5.68E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 2.34E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 2.64E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 1.36E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 8.53E-06 9.00E-08 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 3.71E-06 3.71E-06 mr1340 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 6.95E-06 6.95E-06 mr1429 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 8.10E-06 8.11E-06 mr1452 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 9.87E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 2.52E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 1.53E-06 1.52E-06 mr1513 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 6.65E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 1.24E-06 4.86E-07 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 1.71E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 8.70E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 7.90E-07 4.86E-08 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 2.56E-06 mr1815 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 1.04E-06 1.04E-06 mr1964 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 1.85E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218084463 NA 7.01E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251