Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218068872:

Variant ID: vg1218068872 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18068872
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGACGAAGCGACGCGGCTCGGCCTGGGCCTGCACTGCAGTTCTCGTGGTGTAGGGCCGGTGGGCAGGGCGGCAGGCGAAGTGACGCGCACGCGCACG[C/T]
GCACTGCTCCCTGGCTGATCGCTGATTCGCTGAGCAGTTGAGGGCGGCCTGAGGCGCGCGTCTGGGGCTCTGGGCTGTGGCTAGGCCTGTTGGCCGGGCT

Reverse complement sequence

AGCCCGGCCAACAGGCCTAGCCACAGCCCAGAGCCCCAGACGCGCGCCTCAGGCCGCCCTCAACTGCTCAGCGAATCAGCGATCAGCCAGGGAGCAGTGC[G/A]
CGTGCGCGTGCGCGTCACTTCGCCTGCCGCCCTGCCCACCGGCCCTACACCACGAGAACTGCAGTGCAGGCCCAGGCCGAGCCGCGTCGCTTCGTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.10% 0.15% 0.19% NA
All Indica  2759 70.90% 28.60% 0.18% 0.29% NA
All Japonica  1512 99.50% 0.40% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.00% 0.17% NA
Indica II  465 59.60% 40.00% 0.00% 0.43% NA
Indica III  913 59.00% 40.50% 0.33% 0.11% NA
Indica Intermediate  786 71.40% 27.90% 0.25% 0.51% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218068872 C -> DEL N N silent_mutation Average:77.426; most accessible tissue: Zhenshan97 young leaf, score: 90.985 N N N N
vg1218068872 C -> T LOC_Os12g30130.1 intron_variant ; MODIFIER silent_mutation Average:77.426; most accessible tissue: Zhenshan97 young leaf, score: 90.985 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218068872 C T 0.04 0.05 0.02 0.1 0.09 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218068872 3.05E-06 NA mr1232 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 3.91E-06 5.37E-07 mr1232 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 NA 1.96E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 9.23E-06 NA mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 NA 3.04E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 NA 2.08E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 4.36E-06 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 9.30E-06 1.01E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 NA 8.87E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 NA 4.44E-12 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068872 NA 2.30E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251