\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218068231:

Variant ID: vg1218068231 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18068231
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGTTATATCTAATTTTTTTTACTTCTAATACATACAGTATACTCTATAAAGCACATATACCATAGAGTGACACAAATAAACATTTTTAACACGGTAAA[T/C]
AATAAATCAAGCAGTTTGCAAGTTGCGATAGAGCAATTTAATCTTTAATAAATAATATCAATAGTATAATTGACAACTAAAAATACCATAGAAACAAATT

Reverse complement sequence

AATTTGTTTCTATGGTATTTTTAGTTGTCAATTATACTATTGATATTATTTATTAAAGATTAAATTGCTCTATCGCAACTTGCAAACTGCTTGATTTATT[A/G]
TTTACCGTGTTAAAAATGTTTATTTGTGTCACTCTATGGTATATGTGCTTTATAGAGTATACTGTATGTATTAGAAGTAAAAAAAATTAGATATAACTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 21.10% 0.19% 0.00% NA
All Indica  2759 64.40% 35.30% 0.25% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 20.30% 79.70% 0.00% 0.00% NA
Indica II  465 88.00% 12.00% 0.00% 0.00% NA
Indica III  913 80.30% 19.60% 0.11% 0.00% NA
Indica Intermediate  786 65.40% 33.80% 0.76% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218068231 T -> C LOC_Os12g30130.1 upstream_gene_variant ; 336.0bp to feature; MODIFIER silent_mutation Average:34.085; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg1218068231 T -> C LOC_Os12g30120-LOC_Os12g30130 intergenic_region ; MODIFIER silent_mutation Average:34.085; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218068231 NA 1.22E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 6.08E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 6.16E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 3.32E-06 NA mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 6.52E-07 3.21E-07 mr1590 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 6.99E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 9.40E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 4.38E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 3.23E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 1.64E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068231 NA 1.22E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251