\
| Variant ID: vg1218067516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18067516 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.07, others allele: 0.00, population size: 27. )
CACAATAGTTATACCTCATTTACACCCCACTTACATATATAATTGGTATGTAATTTTCGAATTTACATATGTAATTTTAGTACTTACATATATAATTTTG[T/A]
GACTTACATTGTAAATACACTAAAATTACATATGTAATTTAGGGACTTACAGTGTAAATAAATACCGACTATTTTTTGATGAAAAATATGGCGCCATATA
TATATGGCGCCATATTTTTCATCAAAAAATAGTCGGTATTTATTTACACTGTAAGTCCCTAAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTC[A/T]
CAAAATTATATATGTAAGTACTAAAATTACATATGTAAATTCGAAAATTACATACCAATTATATATGTAAGTGGGGTGTAAATGAGGTATAACTATTGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.80% | 14.20% | 1.16% | 58.80% | NA |
| All Indica | 2759 | 40.50% | 1.40% | 1.63% | 56.43% | NA |
| All Japonica | 1512 | 5.40% | 36.00% | 0.20% | 58.47% | NA |
| Aus | 269 | 1.90% | 23.40% | 0.74% | 73.98% | NA |
| Indica I | 595 | 81.00% | 1.00% | 0.34% | 17.65% | NA |
| Indica II | 465 | 15.70% | 2.40% | 0.22% | 81.72% | NA |
| Indica III | 913 | 27.60% | 0.40% | 2.96% | 69.00% | NA |
| Indica Intermediate | 786 | 39.60% | 2.30% | 1.91% | 56.23% | NA |
| Temperate Japonica | 767 | 0.40% | 63.40% | 0.26% | 35.98% | NA |
| Tropical Japonica | 504 | 4.40% | 1.80% | 0.20% | 93.65% | NA |
| Japonica Intermediate | 241 | 23.20% | 20.30% | 0.00% | 56.43% | NA |
| VI/Aromatic | 96 | 0.00% | 3.10% | 3.12% | 93.75% | NA |
| Intermediate | 90 | 16.70% | 26.70% | 2.22% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218067516 | T -> DEL | N | N | silent_mutation | Average:28.314; most accessible tissue: Callus, score: 52.127 | N | N | N | N |
| vg1218067516 | T -> A | LOC_Os12g30130.1 | upstream_gene_variant ; 1051.0bp to feature; MODIFIER | silent_mutation | Average:28.314; most accessible tissue: Callus, score: 52.127 | N | N | N | N |
| vg1218067516 | T -> A | LOC_Os12g30120-LOC_Os12g30130 | intergenic_region ; MODIFIER | silent_mutation | Average:28.314; most accessible tissue: Callus, score: 52.127 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218067516 | NA | 5.63E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 1.92E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 6.41E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 1.22E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 9.38E-13 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 2.98E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 2.79E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | 3.66E-06 | 3.01E-12 | mr1624 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 3.53E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 3.19E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 4.52E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 9.58E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 8.35E-13 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | 4.82E-07 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | 4.48E-06 | 3.82E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 2.52E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 2.01E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 9.66E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218067516 | NA | 6.47E-07 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |