\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218065256:

Variant ID: vg1218065256 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18065256
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATATAAAGTCTTTAGACCGTCCTATTTGACCCAGATGATATTCAAATCTAAGTTTAGGGACCGAGGTGACACAACTGAACAAGTTGGAGAATCTAAA[T/C]
GAGTGATCTGCAATTTTAGGGACCGGGATGACATAGTTGAACAAGTTTGAGGACCTGAACGGTCGATTTGCGAGTTTAGGGACCGCTATGACACAGCGGT

Reverse complement sequence

ACCGCTGTGTCATAGCGGTCCCTAAACTCGCAAATCGACCGTTCAGGTCCTCAAACTTGTTCAACTATGTCATCCCGGTCCCTAAAATTGCAGATCACTC[A/G]
TTTAGATTCTCCAACTTGTTCAGTTGTGTCACCTCGGTCCCTAAACTTAGATTTGAATATCATCTGGGTCAAATAGGACGGTCTAAAGACTTTATATTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 32.20% 1.65% 1.99% NA
All Indica  2759 74.40% 19.60% 2.65% 3.37% NA
All Japonica  1512 45.30% 54.50% 0.20% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 90.30% 9.10% 0.50% 0.17% NA
Indica II  465 63.70% 26.50% 5.16% 4.73% NA
Indica III  913 73.10% 19.40% 2.19% 5.37% NA
Indica Intermediate  786 70.20% 23.80% 3.31% 2.67% NA
Temperate Japonica  767 64.80% 35.10% 0.13% 0.00% NA
Tropical Japonica  504 22.80% 77.00% 0.20% 0.00% NA
Japonica Intermediate  241 30.30% 69.30% 0.41% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 65.60% 31.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218065256 T -> C LOC_Os12g30130.1 upstream_gene_variant ; 3311.0bp to feature; MODIFIER silent_mutation Average:34.46; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1218065256 T -> C LOC_Os12g30120-LOC_Os12g30130 intergenic_region ; MODIFIER silent_mutation Average:34.46; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1218065256 T -> DEL N N silent_mutation Average:34.46; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218065256 NA 2.75E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 5.10E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 3.61E-06 7.79E-07 mr1030 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 5.44E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 7.98E-06 1.55E-07 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 1.88E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 3.65E-07 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 1.14E-07 1.11E-11 mr1192 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 1.20E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 4.66E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 4.27E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 7.46E-06 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 1.46E-06 NA mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 3.90E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 4.61E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 4.57E-06 4.56E-06 mr1356 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 3.84E-06 8.50E-07 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 5.94E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 1.48E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 7.66E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 7.93E-07 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 5.09E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 2.82E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 6.84E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 1.71E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 9.70E-06 7.60E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 2.63E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 2.50E-07 7.14E-09 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 2.18E-06 1.27E-06 mr1738 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 4.34E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 5.74E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 3.20E-06 mr1786 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 3.58E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 8.04E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218065256 NA 3.63E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251