\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218064709:

Variant ID: vg1218064709 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18064709
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAGATGGGGTGGGAATTGAGCGGTATTTTGTATAAAGAGTAAAGTCCATCACCGGTCTCTAAACTTGTACCGCTGTGTCATCCCGGTCCCTAAACTCA[T/C]
AAATCGACCATTCAGGTCCTCAAACTTGTTCGACTGTGTCATCCCAGTCCCTAAACTTACAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGTC

Reverse complement sequence

GACACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTGTAAGTTTAGGGACTGGGATGACACAGTCGAACAAGTTTGAGGACCTGAATGGTCGATTT[A/G]
TGAGTTTAGGGACCGGGATGACACAGCGGTACAAGTTTAGAGACCGGTGATGGACTTTACTCTTTATACAAAATACCGCTCAATTCCCACCCCATCTCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 17.90% 5.80% 6.52% NA
All Indica  2759 53.20% 26.20% 9.71% 10.95% NA
All Japonica  1512 94.70% 5.00% 0.13% 0.13% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 91.10% 7.60% 0.50% 0.84% NA
Indica II  465 35.10% 30.50% 18.49% 15.91% NA
Indica III  913 37.30% 36.40% 11.06% 15.22% NA
Indica Intermediate  786 53.60% 25.80% 9.92% 10.69% NA
Temperate Japonica  767 99.10% 0.70% 0.00% 0.26% NA
Tropical Japonica  504 95.60% 4.20% 0.20% 0.00% NA
Japonica Intermediate  241 78.80% 20.70% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 85.60% 7.80% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218064709 T -> C LOC_Os12g30130.1 upstream_gene_variant ; 3858.0bp to feature; MODIFIER silent_mutation Average:35.086; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1218064709 T -> C LOC_Os12g30120-LOC_Os12g30130 intergenic_region ; MODIFIER silent_mutation Average:35.086; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1218064709 T -> DEL N N silent_mutation Average:35.086; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218064709 NA 3.14E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 2.33E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 3.37E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 1.75E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 5.54E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 9.88E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 4.21E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 9.48E-06 9.44E-06 mr1340 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 4.33E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 1.76E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 3.61E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 5.79E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 1.58E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 5.92E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 6.62E-06 6.63E-06 mr1462 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 6.98E-06 6.98E-06 mr1462 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 2.83E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 9.13E-06 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 1.51E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 4.62E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 5.19E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 3.81E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 5.96E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 6.05E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 1.13E-06 NA mr1557_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709 NA 4.53E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251