Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218064709:

Variant ID: vg1218064709 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18064709
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAGATGGGGTGGGAATTGAGCGGTATTTTGTATAAAGAGTAAAGTCCATCACCGGTCTCTAAACTTGTACCGCTGTGTCATCCCGGTCCCTAAACTCA[T/C]
AAATCGACCATTCAGGTCCTCAAACTTGTTCGACTGTGTCATCCCAGTCCCTAAACTTACAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGTC

Reverse complement sequence

GACACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTGTAAGTTTAGGGACTGGGATGACACAGTCGAACAAGTTTGAGGACCTGAATGGTCGATTT[A/G]
TGAGTTTAGGGACCGGGATGACACAGCGGTACAAGTTTAGAGACCGGTGATGGACTTTACTCTTTATACAAAATACCGCTCAATTCCCACCCCATCTCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	17.90%	5.80%	6.52%	NA
All Indica	2759	53.20%	26.20%	9.71%	10.95%	NA
All Japonica	1512	94.70%	5.00%	0.13%	0.13%	NA
Aus	269	85.10%	14.90%	0.00%	0.00%	NA
Indica I	595	91.10%	7.60%	0.50%	0.84%	NA
Indica II	465	35.10%	30.50%	18.49%	15.91%	NA
Indica III	913	37.30%	36.40%	11.06%	15.22%	NA
Indica Intermediate	786	53.60%	25.80%	9.92%	10.69%	NA
Temperate Japonica	767	99.10%	0.70%	0.00%	0.26%	NA
Tropical Japonica	504	95.60%	4.20%	0.20%	0.00%	NA
Japonica Intermediate	241	78.80%	20.70%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	2.10%	1.04%	1.04%	NA
Intermediate	90	85.60%	7.80%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218064709	T -> C	LOC_Os12g30130.1	upstream_gene_variant ; 3858.0bp to feature; MODIFIER	silent_mutation	Average:35.086; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1218064709	T -> C	LOC_Os12g30120-LOC_Os12g30130	intergenic_region ; MODIFIER	silent_mutation	Average:35.086; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1218064709	T -> DEL	N	N	silent_mutation	Average:35.086; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218064709	NA	3.14E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	2.33E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	3.37E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	1.75E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	5.54E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	9.88E-06	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	4.21E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	9.48E-06	9.44E-06	mr1340	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	4.33E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	1.76E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	3.61E-06	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	5.79E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	1.58E-06	NA	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	5.92E-09	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	6.62E-06	6.63E-06	mr1462	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	6.98E-06	6.98E-06	mr1462	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	2.83E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	9.13E-06	mr1577	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	1.51E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	4.62E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	5.19E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	3.81E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	5.96E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	6.05E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	1.13E-06	NA	mr1557_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064709	NA	4.53E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251