\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218064708:

Variant ID: vg1218064708 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18064708
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CATGAGATGGGGTGGGAATTGAGCGGTATTTTGTATAAAGAGTAAAGTCCATCACCGGTCTCTAAACTTGTACCGCTGTGTCATCCCGGTCCCTAAACTC[A/G,T]
TAAATCGACCATTCAGGTCCTCAAACTTGTTCGACTGTGTCATCCCAGTCCCTAAACTTACAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGT

Reverse complement sequence

ACACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTGTAAGTTTAGGGACTGGGATGACACAGTCGAACAAGTTTGAGGACCTGAATGGTCGATTTA[T/C,A]
GAGTTTAGGGACCGGGATGACACAGCGGTACAAGTTTAGAGACCGGTGATGGACTTTACTCTTTATACAAAATACCGCTCAATTCCCACCCCATCTCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 16.10% 5.65% 6.54% T: 0.34%
All Indica  2759 55.80% 23.10% 9.50% 10.98% T: 0.58%
All Japonica  1512 94.80% 5.00% 0.07% 0.13% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 91.10% 7.60% 0.50% 0.84% NA
Indica II  465 36.30% 29.50% 18.28% 15.91% NA
Indica III  913 42.60% 29.50% 10.84% 15.33% T: 1.75%
Indica Intermediate  786 56.00% 23.80% 9.54% 10.69% NA
Temperate Japonica  767 99.20% 0.50% 0.00% 0.26% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 20.70% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 85.60% 7.80% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218064708 A -> DEL N N silent_mutation Average:35.06; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1218064708 A -> G LOC_Os12g30130.1 upstream_gene_variant ; 3859.0bp to feature; MODIFIER silent_mutation Average:35.06; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1218064708 A -> G LOC_Os12g30120-LOC_Os12g30130 intergenic_region ; MODIFIER silent_mutation Average:35.06; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1218064708 A -> T LOC_Os12g30130.1 upstream_gene_variant ; 3859.0bp to feature; MODIFIER silent_mutation Average:35.06; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1218064708 A -> T LOC_Os12g30120-LOC_Os12g30130 intergenic_region ; MODIFIER silent_mutation Average:35.06; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218064708 NA 5.94E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 6.51E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 1.52E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 2.32E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 8.48E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 1.92E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 9.48E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 2.12E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 1.51E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 8.29E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 3.12E-06 3.13E-06 mr1462 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 7.88E-06 7.88E-06 mr1462 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 1.99E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 4.07E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 3.31E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 1.52E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 3.07E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 4.81E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 6.45E-06 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218064708 NA 3.89E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251