\
| Variant ID: vg1218055139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18055139 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )
TCCGATATGATAGGGACTTAAAAGTTTTAGTACCATCTAAACAAGGTCTAGACTCCGCTGCTACCCGAACATTTCAAGAAATGTATTCACTTGTGATGCT[A/T]
ACTCTGTAAATTCAGATTCTATATACAAATGCAGACATGCTGTAGAAAACAAATTCTGACCAGTGGAATGGAGAAGAAAGAGTAGGCTCACATTTGTTAG
CTAACAAATGTGAGCCTACTCTTTCTTCTCCATTCCACTGGTCAGAATTTGTTTTCTACAGCATGTCTGCATTTGTATATAGAATCTGAATTTACAGAGT[T/A]
AGCATCACAAGTGAATACATTTCTTGAAATGTTCGGGTAGCAGCGGAGTCTAGACCTTGTTTAGATGGTACTAAAACTTTTAAGTCCCTATCATATCGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218055139 | A -> T | LOC_Os12g30120-LOC_Os12g30130 | intergenic_region ; MODIFIER | silent_mutation | Average:32.01; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218055139 | NA | 7.11E-07 | Grain_weight | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1218055139 | 3.78E-07 | 2.77E-23 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 5.62E-06 | 3.80E-20 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 3.24E-06 | 4.90E-22 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 4.32E-14 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 5.15E-07 | 1.43E-23 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 3.00E-06 | 1.84E-22 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 1.14E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 2.19E-08 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 7.40E-07 | 6.37E-19 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 3.34E-15 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 2.64E-06 | 1.21E-21 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 3.31E-06 | 8.17E-07 | mr1265 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 6.85E-06 | mr1265 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 8.83E-08 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 2.94E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 2.27E-06 | 1.17E-21 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 8.49E-07 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 2.43E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 4.00E-09 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 2.57E-06 | 2.81E-20 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 7.17E-16 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 1.98E-06 | 5.59E-17 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 8.62E-06 | mr1577 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 9.06E-06 | mr1580 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 2.36E-06 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 1.89E-06 | mr1792 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 3.19E-06 | 2.50E-07 | mr1803 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 9.63E-08 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 4.62E-06 | mr1884 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 8.02E-07 | 1.22E-25 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 2.94E-16 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 5.72E-08 | 2.94E-29 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 2.84E-07 | 1.98E-23 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 3.06E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 8.44E-10 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 5.92E-07 | 1.22E-22 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 1.96E-07 | 2.93E-27 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 4.36E-10 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 2.35E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 4.22E-08 | 1.02E-25 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 5.77E-11 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | 1.15E-06 | 2.35E-22 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 1.39E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218055139 | NA | 7.44E-06 | mr1780_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |