Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218054911:

Variant ID: vg1218054911 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 18054911
Reference Allele: GCT	Alternative Allele: ACT,G
Primary Allele: GCT	Secondary Allele: ACT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATTAGATATAGACTACTTACAAAACTAATTACATAAATGAAAACTAATTCGCGAGACAAATATTTTAAGCCTAATTAATCCATAATTAGAGAATGTTT[GCT/ACT,G]
GTAGCATCACATAGGCTAATCATAGATTAATTAGGCTCAATAGATTCGTCTCACGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTT

Reverse complement sequence

AAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGTGAGACGAATCTATTGAGCCTAATTAATCTATGATTAGCCTATGTGATGCTAC[AGC/AGT,C]
AAACATTCTCTAATTATGGATTAATTAGGCTTAAAATATTTGTCTCGCGAATTAGTTTTCATTTATGTAATTAGTTTTGTAAGTAGTCTATATCTAATAC

Allele Frequencies:

Populations	Population Size	Frequency of GCT(primary allele)	Frequency of ACT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	25.70%	0.13%	0.83%	G: 0.47%
All Indica	2759	86.40%	11.30%	0.11%	1.41%	G: 0.72%
All Japonica	1512	50.60%	49.10%	0.20%	0.00%	G: 0.13%
Aus	269	73.60%	26.40%	0.00%	0.00%	NA
Indica I	595	96.80%	2.90%	0.00%	0.00%	G: 0.34%
Indica II	465	74.20%	25.40%	0.00%	0.43%	NA
Indica III	913	85.40%	10.60%	0.00%	3.94%	NA
Indica Intermediate	786	86.90%	10.30%	0.38%	0.13%	G: 2.29%
Temperate Japonica	767	65.40%	34.00%	0.26%	0.00%	G: 0.26%
Tropical Japonica	504	27.20%	72.60%	0.20%	0.00%	NA
Japonica Intermediate	241	52.30%	47.70%	0.00%	0.00%	NA
VI/Aromatic	96	33.30%	66.70%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218054911	GCT -> DEL	N	N	silent_mutation	Average:38.792; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1218054911	GCT -> G	LOC_Os12g30120-LOC_Os12g30130	intergenic_region ; MODIFIER	silent_mutation	Average:38.792; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1218054911	GCT -> ACT	LOC_Os12g30120-LOC_Os12g30130	intergenic_region ; MODIFIER	silent_mutation	Average:38.792; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218054911	NA	2.11E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	2.41E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	4.23E-06	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	3.71E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	4.68E-08	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	9.24E-06	mr1284	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	5.53E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	9.49E-07	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	6.69E-06	6.80E-09	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	2.09E-06	9.95E-10	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	8.79E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	6.48E-06	4.33E-08	mr1492	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	1.04E-09	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	3.01E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	3.08E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	1.03E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	1.67E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	6.17E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	1.19E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	3.90E-06	2.96E-09	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	6.86E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	3.92E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	3.00E-07	5.45E-12	mr1797	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	3.00E-07	5.45E-12	mr1801	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	9.45E-07	mr1802	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	6.99E-09	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	4.53E-07	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	3.68E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	8.58E-07	mr1816	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	4.19E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	NA	7.69E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218054911	5.62E-06	6.47E-09	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251